[ grepme84 @ 13.10.2004. 20:44 ] @
Pozdrav svima,

otvaram temu jer bih volijo da vidim sta vi ustvari mislite o VI.
Ja mislim da nece nikad moci kompjuteri da MISLE ni da RAZMISLJAJU (kao sto to neki pricaju).Ja na to gledam kao na masinu koja zna samo IF THEN i na takav nacin ona 'uci' ali to nije to.

Sta vi mislite?
Oce li biti 'mislecih' masina?
Ako nece, da li se isplati uopste raditi na nekim VI projektima?
Kako vi gledate na ALICE bot-a?
Da li radite na nekom VI projektu?
Da li vjerujete u to (da li stvarno razmislja)?

Recite mi vase misljenje.Hocu prvo da znam sta ljudi ustvari misle prije nego sto pocnem da se ozbiljnijem bavim time.
[ Reljam @ 13.10.2004. 21:35 ] @
Daniel, u cemu je razlika izmedju masine koja kako ti kazes 'MISLI', i masine koja isto to radi pomocu 'if then'-a? Da li je korisniku bitno koje je od ta dva u pitanju?
[ Gojko Vujovic @ 13.10.2004. 22:51 ] @
Pa prirodnije bi delovala mašina u odnosu sa čovekom kad bi mogla svojevoljno da odlučuje, pošto je if/then ponašanje predvidivo ako ti je poznat dovoljan broj parametara koji utiču na odluku. I što si više u kontaktu sa if/then misliocem, naučiš da predviđaš njegove postupke, što na kraju dosadi i shvatiš da je to i dalje samo metalna kanta.
[ Reljam @ 13.10.2004. 22:57 ] @
Posle koliko velikog broja pravila ta razlika postaje zanemarljiva? Pogotovu u kontekstu ekspertnog sistema koji je namenjen da radi u nekom konkretnom polju?
[ srki @ 13.10.2004. 23:09 ] @
Citat:
Gojko Vujovic: Pa prirodnije bi delovala mašina u odnosu sa čovekom kad bi mogla svojevoljno da odlučuje, pošto je if/then ponašanje predvidivo

A mislis da covekovo ponasanje i razmisljanje nije ogroman skup if/then/else uslova?
Citat:
ako ti je poznat dovoljan broj parametara koji utiču na odluku.

To da. Isto kao i procesi misljenja u mozgu koji su samo proizvod biohemijskih reakcija. Ako ti znas polozaje molekula i elektrona u velikom broju slucajeva bi mogao da predvidis sta ce se posle desiti ako imas dovoljno brz racunar koji niko nema :)

Citat:
I što si više u kontaktu sa if/then misliocem, naučiš da predviđaš njegove postupke, što na kraju dosadi i shvatiš da je to i dalje samo metalna kanta.


Ali radi se na tome da se to sto vise usavrsi da ne mozes da provalis da pricas sa metalnom kantom.
[ mucky @ 13.10.2004. 23:15 ] @
Cini mi se da vec sada postoje ljudi koji bi za ALICE bot rekli da je covek :)
U svakom slucaju, slazem se sa Gojkom u vezi if-then percepcije... Nekako
nije to to... Nema obrve, kao shto je Zappa rekao :)

--
Visit my photolog at http://www.fotolog.net/mucky
[ Milan Andjelkovic @ 13.10.2004. 23:28 ] @
Citat:
srki: A mislis da covekovo ponasanje i razmisljanje nije ogroman skup if/then/else uslova?

Čovekovo ponašanje je uslovljeno i emocijama i drugim ne-racionalnim faktorima koji nisu svojstveni mašinama, a često su predstavljaju vrlo bitni. Ne bih rekao da je za sada izvodljivo implementirati tech-ekvivalent emocijama (i sl.) u zadovoljavajućem obliku.

Čini mi se da je to jedna od krucijalnih razlika čovekove inteligencije i VI.
[ Bojan Basic @ 13.10.2004. 23:34 ] @
Citat:
Milan Andjelkovic:
Čovekovo ponašanje je uslovljeno i emocijama i drugim ne-racionalnim faktorima koji nisu svojstveni mašinama, a često su predstavljaju vrlo bitni.

Apsolutno netačno. To što ti nazivaš "emocija" zapravo je samo još jedna biohemijska reakcija koja je, pogađate već, if-then petlja.
[ Ivan Dimkovic @ 13.10.2004. 23:36 ] @
Thinking outside of the system - to je razlika izmedju coveka i masine - covek ima ovu mogucnost - masina uvek mora da misli unutar svog bootstrap koda - tj. nikad ne moze da izadje iz tog algoritma.

After all -

Najmocniji kompjuter nikad nece reci za ovu recenicu da je tacna ? ;)

(mada primenom fuzzy logike ovo moze nekako da se resi ;)

Problem je konceptualne prirode - kompjuteri i dan danas se baziraju na algoritmima i bulovoj logici (0 i 1) - dok je covekov CNS baziran na biohemiji koja ipak moze da ima neki stepen slobode zbog same fizicke neodredjenosti i sl...

[Ovu poruku je menjao Ivan Dimkovic dana 14.10.2004. u 00:38 GMT+1]
[ mucky @ 13.10.2004. 23:37 ] @
Pa kao što sam i rekao :) OBRVE :)

Šalu na stranu, trebali ste čoveku odmah odgovoriti u čemu je najveći problem.
Najveći problem na putu kojim veštačka inteligencija treba da prođe da
bi postala
ljudska inteligencija (def. VI uopšte i ne govori o vezama sa
ljudskom) jeste taj što
je "hardver" jednostavno drugačiji. U mozgu rade potpuno paralelno
milijarde impulsa
sa milijardama nervnih ćelija, dok (nadam se) znaš kako radi CPU.
Znači, babe i žabe.


OffTopic:
Gojko, kada sa Gmail-a odgovorim na temu, a koristim "Serbian" character set, pojavljuju se "kuke i kvake"... Kao npr:

=C5=A0alu na stranu, trebali ste =C4=8Doveku odmah odgovoriti u =C4=8Demu j=
e najve=C4=87i problem.

--
Visit my photolog at http://www.fotolog.net/mucky
[ Milan Andjelkovic @ 13.10.2004. 23:43 ] @
Citat:
Bojan Basic: Apsolutno netačno. To što ti nazivaš "emocija" zapravo je samo još jedna biohemijska reakcija koja je, pogađate već, if-then petlja.

A šta ćemo sa npr. intuicijom? Šta je sa ne-racionalnim razmišljanjem, predosećajima, itd...?
[ Ivan Dimkovic @ 13.10.2004. 23:43 ] @
Nego, zanima me zasto mislite da su nervi if-then petlje?

Ono malo sto znam o CNS-u je da neuron ima svoje terminalne zavrsetke (nekad i nekoliko desetina) koji imaju thresholde aktivacije, i finalni impuls je rezultanta aktivacije tih zavrsetaka - a sami elektroni koji prolaze kroz te zavrsetke (i aktivaciji istih) su podlozni necemu sto nije bas svodljivo na prost "if-then' vec zavisi i od nekih fizickih faktora koji nisu 0 ili 1 vec mogu biti i ono nezgodno kvantno "izmedju" ;)

Dakle, to je kompleksan sistem baziran na principu neodredjenosti - i kako se ukrupnjava samo se moze grubo simulirati statistikom i verovatnocom...

Mozda ovi kvantni racunari to nadomeste...


[ Bojan Basic @ 13.10.2004. 23:49 ] @
Citat:
Milan Andjelkovic:
A šta ćemo sa npr. intuicijom? Šta je sa ne-racionalnim razmišljanjem, predosećajima, itd...?

Šta sa intuicijom? Čovekova trenutna misao zapravo predstavlja samo trenutni položaj neurona kao nosioce informacije. E sad ti neuroni se kreću na određeni način koji bi se mogao implementirati u program kada bismo imali dovoljno jake kompjutere i kada bismo znali sve detalje tog kretanja. Ono što ti kažeš: "sinulo mi je u trenutku" znači samo da je u tom trenutku položaj neurona bio takav, isto važi i za predosećaj i sve ostalo što nabrojiš.
[ Milan Andjelkovic @ 13.10.2004. 23:49 ] @
Citat:
Ivan Dimkovic: Nego, zanima me zasto mislite da su nervi if-then petlje?

Ono malo sto znam o CNS-u je da neuron ima svoje terminalne zavrsetke (nekad i nekoliko desetina) koji imaju thresholde aktivacije, i finalni impuls je rezultanta aktivacije tih zavrsetaka - a sami elektroni koji prolaze kroz te zavrsetke (i aktivaciji istih) su podlozni necemu sto nije bas svodljivo na prost "if-then' vec zavisi i od nekih fizickih faktora koji nisu 0 ili 1 vec mogu biti i ono nezgodno kvantno "izmedju" ;)

Dakle, to je kompleksan sistem baziran na principu neodredjenosti - i kako se ukrupnjava samo se moze grubo simulirati statistikom i verovatnocom...

Mozda ovi kvantni racunari to nadomeste...

Pa, koliko sam ja upoznat, CNS se svodi na jedan komplikovan if-then sistem. Jedan elektron ili impuls moze ili da izazove nadrazaj i reakciju ili ne. Ako govorimo o snazi nadrazaja, on je opet uslovljen vrstom ili brojem impulsa. Što se tiče ostalih faktora/uticaja, njih takođe ili nema ili ih ima u nekoj konkretnoj količini.
[ Milan Andjelkovic @ 13.10.2004. 23:55 ] @
Citat:
Bojan Basic: Šta sa intuicijom? Čovekova trenutna misao zapravo predstavlja samo trenutni položaj neurona kao nosioce informacije. E sad ti neuroni se kreću na određeni način koji bi se mogao implementirati u program kada bismo imali dovoljno jake kompjutere i kada bismo znali sve detalje tog kretanja. Ono što ti kažeš: "sinulo mi je u trenutku" znači samo da je u tom trenutku položaj neurona bio takav, isto važi i za predosećaj i sve ostalo što nabrojiš.

"Šta bi bilo kad bi bilo?"

Ja baš i pričam o tome da trenutno ne postoji dovoljno napredna tehnologija da simulira ljudski um. Možda će jednoga dana postojati, ali za sada čak nije dovoljno jasno ni funkcionisanje ljudsog uma, što će reći da ostaju "emocije" kao jedna od trenutno nepremestivih razlika, što se može objasniti i drugačije, kao što je to učinio Ivan.
[ Bojan Basic @ 14.10.2004. 00:00 ] @
To što mi ne znamo algoritam ne znači da algoritam ne postoji. Znači, ja tvrdim da je reakcija čoveka u zavisnosti od spoljašnjih uticaja u potpunosti isprogramirana i tu nema mesta slučajnostima.
Citat:
Ivan Dimkovic:
Thinking outside of the system - to je razlika izmedju coveka i masine - covek ima ovu mogucnost - masina uvek mora da misli unutar svog bootstrap koda - tj. nikad ne moze da izadje iz tog algoritma.

Ovaj Ivanov odgovor koji si spomenuo predstavlja suprotno stanovište od mog - ja kažem da i čovek ima svoj kod koji je, tu se slažemo, znatno složeniji od bilo koje mašine, ali ono što je bitno je da postoji.

Sad odoh da spavam da ne bih odmah video izlive besa posle ovog mog odgovora...
[ Reljam @ 14.10.2004. 00:06 ] @
Ivane, cini mi se da opisujes fuzzy logic, a to je naravno bazirano na if-thenu, zar ne?
[ srki @ 14.10.2004. 00:15 ] @
Citat:
mucky: Najveći problem na putu kojim veštačka inteligencija treba da prođe da
bi postala ljudska inteligencija (def. VI uopšte i ne govori o vezama sa ljudskom) jeste taj što je "hardver" jednostavno drugačiji. U mozgu rade potpuno paralelno milijarde impulsa sa milijardama nervnih ćelija, dok (nadam se) znaš kako radi CPU. Znači, babe i žabe.

Paralelne operacije mogu da se simuliraju sekvencijalnim operacijama. Takodje i kod procesora se gomila operacija desava paralelno (upis u memoriju, citanje iz memorije, dekodiranje instrukcije, izvrsavanje instrukcije itd...)
[ Milan Andjelkovic @ 14.10.2004. 00:18 ] @
Citat:
Bojan Basic: To što mi ne znamo algoritam ne znači da algoritam ne postoji.

Ne znači ni da postoji. S obzirom da nam je svakako nepoznat, on za nas trenutno ne postoji.
Citat:
Znači, ja tvrdim da je reakcija čoveka u zavisnosti od spoljašnjih uticaja u potpunosti isprogramirana i tu nema mesta slučajnostima.

Ovaj Ivanov odgovor koji si spomenuo predstavlja suprotno stanovište od mog - ja kažem da i čovek ima svoj kod koji je, tu se slažemo, znatno složeniji od bilo koje mašine, ali ono što je bitno je da postoji.

Vraćamo se na staro - ne vidim nigde argument koji dokazuje da algoritam/kod postoji? Tvoje razmišljanje nije dovoljno potkovano činjenicama da bi se kvalifikovalo kao tvrđenje.
Citat:
Sad odoh da spavam da ne bih odmah video izlive besa posle ovog mog odgovora...

:)
[ Milan Andjelkovic @ 14.10.2004. 00:32 ] @
Kad malo bolje razmislim, čini mi se da smo svi malo omašili... eventualno ostaje Ivanov komentar, jer:
inteligencija != ponašanje (ličnost)

Naime, dve definicije inteligencije koje su mi poznate glase:
Inteligencija je sposobnost snalaženja u novim, nepoznatim situacijama.

ili
Inteligencija je sposobnost učenja uviđanjem ili sposobnost rešavanja problema na osnovu mišljenja.

Prema ovome, "emocije" o kojima smo pričali nisu deo inteligencije, a samu inteligenciju je moguće prilično uspešno simulirati u vidu VI, mada još uvek nije moguće napraviti ekvivalent. S druge strane, simulirati ljudsku ličnost je, kao što sam već navodio, skoro nemoguće.
[ Bojan Basic @ 14.10.2004. 09:31 ] @
Citat:
Milan Andjelkovic:
Ne znači ni da postoji. S obzirom da nam je svakako nepoznat, on za nas trenutno ne postoji.

Šta znači "trenutno ne postoji"? Kao sad ga nema ali za koju hiljadu (ili možda milion, nebitno) će se odjednom stvoriti niotkuda? Ja bih pre rekao da kako je sad tako će biti i nakon nekog vremena, neće odjednom neuroni početi da se kreću shodno nekim pravilima iako su sada, po tvom mišljenju, u potpunosti nepredvidivi. Ajnštajnova čuvena rečenica je: "Bog ne baca kockice" i tu je potpuno u pravu.
Citat:
Milan Andjelkovic:
Vraćamo se na staro - ne vidim nigde argument koji dokazuje da algoritam/kod postoji? Tvoje razmišljanje nije dovoljno potkovano činjenicama da bi se kvalifikovalo kao tvrđenje.

Heh, pa ako ćemo tako onda ni ja ne vidim argument za tvoje tvrđenje, ali nema veze, ja mislim da je svaka razmena mišljenja (pa i sukob stavova) dobrodošla. Evo, pokušaću da objasnim: ljudsko telo se sastoji od gomile čestica, tačno? E sad, razmišljanje je proces koji se obavlja u mozgu, tačno? U tom slučaju ćemo se ograničiti na mozak. Tamo se nalaze čestice koje se zovu neuroni i koji su odgovorni sa proces mišljenja, tačno? Mislim da sad nailazi deo gde se razmimoilazimo. Ja kažem da se kretanje tih neurona može predvideti, dok ti tvrdiš da je to nemoguće. Zamislimo za trenutak da si ti u pravu. Znači, neuroni se kreću po nekom "svom" sistemu i nikad ne znaš gde će sad da odu. Koliko vidim, to znači da neuroni sami odlučuju o svojoj putanji, a zar to ne bi značilo da su oni inteligentna bića? Međutim, pošto neuroni nisu inteligentna bića (tu se, nadam se, slažemo) sasvim je logično da oni ne mogu da odlučuju o svojoj putanji već se ponašaju shodno dejstvu spoljašnjih sila. Gde sam pogrešio?
[ mucky @ 14.10.2004. 09:53 ] @
Ne razumem da li si jednostavno cepidlaka ili si stvarno ubedjen da
racunarski hardware kakav je danas (arhitektonski gledano, bez obzira
na snagu) moze da simulira ljudski mozak?
--
Visit my photolog at http://www.fotolog.net/mucky
[ caboom @ 14.10.2004. 09:58 ] @
hmm... mislim da bi prvo trebalo definisati sta zapravo znaci vestacka inteligencija. pre svega ono sto se danas smatra AI-em je daleko od "mislecih masina". pored ostalog, mislim da bi trebalo definisati i pojam inteligencije. ja sam sklon da verujem da je u pitanju samo slozen click-clack mehanizam, ali vidim da ima i suprotnih misljenja. :)
[ grepme84 @ 14.10.2004. 10:15 ] @
Citat:
Reljam:
Daniel, u cemu je razlika izmedju masine koja kako ti kazes 'MISLI', i masine koja isto to radi pomocu 'if then'-a? Da li je korisniku bitno koje je od ta dva u pitanju?


Na pitanje o razlici odgovorijo je Gojko a na ono drugo, meni je bitno.

Citat:
Gojko:
Pa prirodnije bi delovala mašina u odnosu sa čovekom kad bi mogla svojevoljno da odlučuje, pošto je if/then ponašanje predvidivo ako ti je poznat dovoljan broj parametara koji utiču na odluku. I što si više u kontaktu sa if/then misliocem, naučiš da predviđaš njegove postupke, što na kraju dosadi i shvatiš da je to i dalje samo metalna kanta.


To sam hteo da kazem.


Citat:
Bojan Basic:
Apsolutno netačno. To što ti nazivaš "emocija" zapravo je samo još jedna biohemijska reakcija koja je, pogađate već, if-then petlja.


Hmm...


Citat:
mucky:
Najveći problem na putu kojim veštačka inteligencija treba da prođe da
bi postala
ljudska inteligencija (def. VI uopšte i ne govori o vezama sa
ljudskom) jeste taj što
je "hardver" jednostavno drugačiji. U mozgu rade potpuno paralelno
milijarde impulsa
sa milijardama nervnih ćelija, dok (nadam se) znaš kako radi CPU.
Znači, babe i žabe.


Citat:
Milan Andjelkovic:
Kad malo bolje razmislim, čini mi se da smo svi malo omašili... eventualno ostaje Ivanov komentar, jer:


inteligencija != ponašanje (ličnost)

Naime, dve definicije inteligencije koje su mi poznate glase:

Inteligencija je sposobnost snalaženja u novim, nepoznatim situacijama.

ili

Inteligencija je sposobnost učenja uviđanjem ili sposobnost rešavanja problema na osnovu mišljenja.

Prema ovome, "emocije" o kojima smo pričali nisu deo inteligencije, a samu inteligenciju je moguće prilično uspešno simulirati u vidu VI, mada još uvek nije moguće napraviti ekvivalent. S druge strane, simulirati ljudsku ličnost je, kao što sam već navodio, skoro nemoguće.


Hvala svima na komentarima, dobijo sam ono sto sam trazijo ali volijo bih da jos diskutujete o ovome.

Pozdrav svima
[ Gojko Vujovic @ 14.10.2004. 10:27 ] @
Citat:
caboom: hmm... mislim da bi prvo trebalo definisati sta zapravo znaci vestacka inteligencija. pre svega ono sto se danas smatra AI-em je daleko od "mislecih masina". pored ostalog, mislim da bi trebalo definisati i pojam inteligencije. ja sam sklon da verujem da je u pitanju samo slozen click-clack mehanizam, ali vidim da ima i suprotnih misljenja. :)


Pa nije, jer da jeste - ovi isti tranzistori multiplicirani par hiljada puta bi mogli da izigravaju ljudski mozak za koju godinu. Izostavili ste faktor slucajnosti, greske, odumiranje neurona, bolesti i opste stanje organizma koji uticu na sinapse,... o GENIMA da ne pricamo! Ma sama lista faktora bi bila tesko popisiva (kad je rec o ljudskom mozgu), a zamisli tek matrica interakcije tih faktora?

Kompjuteri danasnjice nisu cak ni na putu da dostignu nesavrsenost ljudskog mozga u ovom pogledu jer se u razvoju cipova i cilja na tacnost, preciznost, brzinu, itd a ne oponasanje mozga.
[ Ivan Dimkovic @ 14.10.2004. 10:51 ] @
Reljam: jeste, fuzzy logika je to - ali ona je opet samo aproksimacija "prave stvari".

Gde ja vidim problem oko AI klona ljudske inteligencije:

- Kao sto rekoh, u samoj osnovi neuronske mreze (aktivacija individualnih terminala) je prirodni haos - tj. neodredjenost, dok je u samoj osnovi racunara odredjenost 0 ili 1

- Racunar dakako moze da "simulira" neodredjenost, ali postavlja se pitanje da li je to zaista to (ne bih da se uplicem u raspravu da li neodredjenost postoji ili je samo nama neodredjeno stanje elektrona... previse boli glava ;)

- BOOTSTRAP kod - ovo je mozda najteze... kako god, mi eventualno mozemo da "kloniramo" mozak uz tu aproksimaciju haosa (malo statistike, malo fuzzy logike) i dovoljan broj tranzistora - ali ono sto ne znamo je inicijalno stanje - bas me zanima kako ce neko da uradi "boot" kod kakav je u mozgu, tj. inicijalno stanje elektrona... "klik-klak" kako kaze Caboom mozda jeste "klik klak" ali mi nemamo ideju kako da postavimo kockice za zad za pocetak igrice :)

- Osnova tog "inicijalnog" (boot) stanja je negde u pocetku lanca DNK (recimo, covek kad se rodi i te kako ume da prepoznaje neke oblike - to je evolutivno negde vec ubaceno u kod).. no opet, ako ste primetili, ni lanac DNK ne pocinje od nule pa da ga reverzno inzenjerisemo, vec od same nulte tacke (zacece) on vec ima vrlo kompleksan boot code ;)

- Bez "boot" koda nas sistem neurona i thresholda izmedju njih nece biti u stanju da radi nista smisleno - eventualno da ga feedbackujemo nekim slucajnim strujama i posmatramo sta se desava...

- Ako nemamo inicijalno stanje, mi onda mozemo "high level" da aproksimiramo neuro procese misljenja, tacno? E bas i nije - jer mozak ne pociva na bulovoj logici... prosto pitanje:

Sta je to sto coveka tera da iskoci iz ove petlje:

p: ova recenica nije tacna -

Covek opet ima slobodnu volju da iterise dokle hoce i u bilo kom, pa cak i slucajnom momentu da kaze "ma jok... ovo je logicka besmislica" ili jednostavno krene da se smeje, ili da se naljuti ili da da vrlo tacan matematicki odgovor zasto ovo nema resenje - ovo je najbanalniji primer, ima jos dosta takvih.

To je nesto sto algoritamski ne moze bas da se simulira danas.. kao ni mnogi problemi za koje ljudski mozak nalazi resenje bas zato sto ne pociva na prostoj "if then" vec na nekom sistemu thresholda u kome ima dosta haosa, neodredjenosti, i sl...

Dakle problem je u 2 stvari - neodredjenost i inicijalno stanje. Tehnicki problemi oko simulacije svega ostalog su vrlo resivi.
[ caboom @ 14.10.2004. 10:57 ] @
Citat:
Gojko Vujovic: Pa nije, jer da jeste - ovi isti tranzistori multiplicirani par hiljada puta bi mogli da izigravaju ljudski mozak za koju godinu. Izostavili ste faktor slucajnosti, greske, odumiranje neurona, bolesti i opste stanje organizma koji uticu na sinapse,... o GENIMA da ne pricamo! Ma sama lista faktora bi bila tesko popisiva (kad je rec o ljudskom mozgu), a zamisli tek matrica interakcije tih faktora?


upravo si opisao slozen click-clack mehanizam :)
[ salec @ 14.10.2004. 11:01 ] @
Mislim da je to problem pokretne mete, tj. problem je u tome sto se nivoi generalizacije i apstrakcije umnozavaju vec samim proucavanjem samog sebe. Uvek postoji jos jedan meta-nivo iznad sadasnjeg. Ako probas da sledis taj put, padas u rekurziju i zbog toga ti se (s pravom) cini da je nemoguce rekonstruisati ljudsku inteligenciju. Zato smatram da je odgovor na pitanje da li je moguce stvoriti vestacku inteligenciju i da i ne. Kljucni trenutak je nastanak i opis masinskog generalnog izvodjenja zakljucaka. A sve ostalo, intuicija i odlucivanje (prelazak na if-then stablo) na bazi neodredjenih informacija, su vec pokriveni fuzzy sistemima. A ako ista preostane sto je izmaklo i Malom Radojici i Deli-Radivoju, pretpostavka je da ce ga neuro mreza izmapirati, ma kako bilo razbacano po prostoru ulaza/izlaza.

E, ono sto nedostaje i sto bi jako koristilo i ovoj "prirodnoj" ljudskoj inteligenciji, bi bilo automatizovano pronalazenje obrazaca, tj. prevodjenje gorepomenutih (kao zadatak za neuromrezu) razmazanih i razbacanih relacija u neko pregledno if-then stablo (automatizacija istrazivanja). To bi bio sledeci veliki pojacivac sposobnosti, posle razvitka medjuljudske komunikacije (govora), uposljavanja snage i percepcije drugih zivih bica (pripitomljavanja zivotinja i drzanja robova...ili zaposlenih...ili na bilo koji drugi nacin uslovljenih ljudi), razvitka sistema akumulacije znanja (pisma), otkrica matematike, mehanizacije, uposljavanje energije prirodnih pojava ("proizvodnja" energije), automatizacije formalizovanih postupaka (kompjuteri) i formiranja globalne interakcije ideja (internet).
[ Bojan Basic @ 14.10.2004. 11:05 ] @
Citat:
mucky:
Ne razumem da li si jednostavno cepidlaka ili si stvarno ubedjen da
racunarski hardware kakav je danas (arhitektonski gledano, bez obzira
na snagu) moze da simulira ljudski mozak?

Da, jesam ubeđen, ako misliš suprotno navedi i zašto.
Citat:
Ivan Dimkovic:
- Racunar dakako moze da "simulira" neodredjenost, ali postavlja se pitanje da li je to zaista to (ne bih da se uplicem u raspravu da li neodredjenost postoji ili je samo nama neodredjeno stanje elektrona... previse boli glava ;)

Ne moraŠ da se uplićeš u raspravu, ja kažem da neodređenost ne postoji i prihvati to tako :)
Citat:
Ivan Dimkovic:
- BOOTSTRAP kod - ovo je mozda najteze... kako god, mi eventualno mozemo da "kloniramo" mozak uz tu aproksimaciju haosa (malo statistike, malo fuzzy logike) i dovoljan broj tranzistora - ali ono sto ne znamo je inicijalno stanje - bas me zanima kako ce neko da uradi "boot" kod kakav je u mozgu, tj. inicijalno stanje elektrona... "klik-klak" kako kaze Caboom mozda jeste "klik klak" ali mi nemamo ideju kako da postavimo kockice za zad za pocetak igrice :)

Jeste, mi ne znamo, ali zašto tvrdiš da naši potomci za koju hiljadu ili milion godina neće znati? Ti i ja ne umemo sada da sednemo i napišemo taj program ali to je samo zbog toga što taj deo sveta nije dovoljno istražen.
Citat:
Ivan Dimkovic:
- Osnova tog "inicijalnog" (boot) stanja je negde u pocetku lanca DNK (recimo, covek kad se rodi i te kako ume da prepoznaje neke oblike - to je evolutivno negde vec ubaceno u kod).. no opet, ako ste primetili, ni lanac DNK ne pocinje od nule pa da ga reverzno inzenjerisemo, vec od same nulte tacke (zacece) on vec ima vrlo kompleksan boot code ;)

Naravno da bi taj program simulirao mozak jednog čoveka, za drugu osobu ide i drugi program, opet ne vidim neslaganje.
Citat:
Ivan Dimkovic:
Covek opet ima slobodnu volju da iterise dokle hoce i u bilo kom, pa cak i slucajnom momentu da kaze "ma jok... ovo je logicka besmislica" ili jednostavno krene da se smeje, ili da se naljuti ili da da vrlo tacan matematicki odgovor zasto ovo nema resenje - ovo je najbanalniji primer, ima jos dosta takvih.

Slučajni momenat ne postoji. To što si ti u slučajnom momentu odustao od nečega i rekao: "ma jok" znači da je u tom momentu splet tvojih neurona dostigao takvu poziciju.

Posmatrajmo to ovako: izdeli ljudski organizam na molekule i za svaki molekul napiši jednačine kretanja, i onda pusti simulaciju u koju su uključeni spoljašnji uslovi i sve ostalo što poželiš. Zašto misliš da neće raditi?
[ Ivan Dimkovic @ 14.10.2004. 11:16 ] @
Citat:

Ne moraŠ da se uplićeš u raspravu, ja kažem da neodređenost ne postoji i prihvati to tako :)


Prove me wrong? ;)

Mislim da na danasnjem stupnju fizike neodredjenost i te kako postoji... dok ne budes imao formulu talasa u kojoj ne postoji taj neodredjeni parametar ti nemas tacnu formulu...

Citat:

Jeste, mi ne znamo, ali zašto tvrdiš da naši potomci za koju hiljadu ili milion godina neće znati? Ti i ja ne umemo sada da sednemo i napišemo taj program ali to je samo zbog toga što taj deo sveta nije dovoljno istražen.


Ovaj... mi ovde pricamo o danasnjem stanju.. buducnost je neodredjena, zar ne? ;)

U svakom slucaju.. za milion godina nam to mozda i nece trebati - mislim da bi bilo pametno skoncentrisati se na danas, ili eventualno sledecih 100-njak godina, da ne bi smo uvodili vremenplove, teleporte i slicne stvari koje eto ja ne mogu da garantujem da nece biti izmisljeni :)

Citat:

Naravno da bi taj program simulirao mozak jednog čoveka, za drugu osobu ide i drugi program, opet ne vidim neslaganje.


Problem je: sto ti NEMAS taj program, i NEMAS nacin da ga izvuces - da li je sada jasnije? ;) Recimo kao neka savrsena zastita od kopiranja ;)

Citat:

Slučajni momenat ne postoji. To što si ti u slučajnom momentu odustao od nečega i rekao: "ma jok" znači da je u tom momentu splet tvojih neurona dostigao takvu poziciju.


Ali problem je sto ti nemas inicijalno stanje funkcije elektrona (ne, nemas) od koga to zavisi - a kao sto rekoh, u jednacini talasa tog elektrona ces morati da ubacis neko rnd() u danasnjem kompjuteru - a to je ipak samo aproksimacija ;)

Dakle - za danasnju nauku to jeste u mnogome slucajno, jer osnova fizike pociva na tome... kad to budemo resili...

Ne znam.. probaj ;)

Citat:

Posmatrajmo to ovako: izdeli ljudski organizam na molekule i za svaki molekul napiši jednačine kretanja, i onda pusti simulaciju u koju su uključeni spoljašnji uslovi i sve ostalo što poželiš. Zašto misliš da neće raditi?


Siguran sam da nece - jer ti nisi mogao da izvuces snapshot trenutnog stanja (talasne funkcije) - dobio bi jedno mrtvo telo u vecini slucajeva... zamisli koja je verovatnoca potrebna da potrefis sve jednacine stanja nekih nekoliko stotina milijardi celija - u danasnjem chipu bi imao nekoliko stotina milijardi rnd() operacija ;) Cenim da bi dobio pljeskavicu na kraju :)

[ mucky @ 14.10.2004. 12:27 ] @
Mislim suprotno, tj. slazem se sa gosn. Dimkovicem. Racunari su determinist=
icki,
dok bi mozak mogao biti nazvan "stohastichkim". Fora je u tome sto
mozak moze da
pronadje nove puteve i tamo gde ih ranije nije bilo, dok kompjuter,
sve i da mu das sve
moguce puteve, ne moze otici dalje od toga (jer i od beskonacnog
postoji vece :). Ne
znam da li si cuo za onaj eksperiment sa stem celijama, gde su
pacovima odsecali parche
kichmene mozhdine, i onda to mesto "hranili" stem celijama. Odsecheni
deo kichmene
mozhdine se regenerisao, ali su nervi bili povezani u potpunom haosu.
Tada je na scenu
nastupio mozak, pomocu kog je pacov ipak prohodao, jer se u centralnom nerv=
nom=20
sistemu izvrsilo premoscavanje.

Znaci, ne mozes kompjuteru dati beskonacno mnogo kombinacija "sta se
moze desiti",
a samo uz pomoc tih informacija bi kompjuter mogao tako nesto uraditi. Nema=
te
samostalnosti u donosenju odluka u nepoznatim situacijama, kao sto je
ima kada je
mozak u pitanju.

--=20
Visit my photolog at http://www.fotolog.net/mucky
[ Milan Andjelkovic @ 14.10.2004. 13:09 ] @
Citat:
Bojan Basic:
Šta znači "trenutno ne postoji"? Kao sad ga nema ali za koju hiljadu (ili možda milion, nebitno) će se odjednom stvoriti niotkuda? Ja bih pre rekao da kako je sad tako će biti i nakon nekog vremena, neće odjednom neuroni početi da se kreću shodno nekim pravilima iako su sada, po tvom mišljenju, u potpunosti nepredvidivi. Ajnštajnova čuvena rečenica je: "Bog ne baca kockice" i tu je potpuno u pravu.

Stvar je u tome što ni ti ni ja ne znamo da li taj algoritam postoji. Ja tvrdim da je simulacija ljudskog uma nemoguća u ovom trenuntku ili u narednih 100god. Možemo da nagađamo šta će biti 7246god. ali nemamo nikakvog osnova da tvrdimo bilo šta.
Ti tvrdiš da algoritam postoji jer će jednog dana biti otkriven, ali poenta je da ti ne znaš da će biti otkriven, tj. ti ne znaš da on postoji. Iznosiš tvrđenje uz neosnovanu pretpostavku. To se zove hipoteza koja baš i nema nekog značaja u ovoj diskusiji.
Citat:
Bojan Basic:
Heh, pa ako ćemo tako onda ni ja ne vidim argument za tvoje tvrđenje...

Moje tvrđenje se nalazi u domenu empirije, a tvoje u domenu ideja. Pročitaj još jednom šta tvrdim i videćeš da ja govorim o trenutnom i blisko-budućem stanju koje je vrlo jasno i poznato. Moj argument je činjenica.
Citat:
Bojan Basic:
Evo, pokušaću da objasnim: ljudsko telo se sastoji od gomile čestica, tačno? E sad, razmišljanje je proces koji se obavlja u mozgu, tačno? U tom slučaju ćemo se ograničiti na mozak. Tamo se nalaze čestice koje se zovu neuroni i koji su odgovorni sa proces mišljenja, tačno? Mislim da sad nailazi deo gde se razmimoilazimo. Ja kažem da se kretanje tih neurona može predvideti, dok ti tvrdiš da je to nemoguće. Zamislimo za trenutak da si ti u pravu. Znači, neuroni se kreću po nekom "svom" sistemu i nikad ne znaš gde će sad da odu. Koliko vidim, to znači da neuroni sami odlučuju o svojoj putanji, a zar to ne bi značilo da su oni inteligentna bića? Međutim, pošto neuroni nisu inteligentna bića (tu se, nadam se, slažemo) sasvim je logično da oni ne mogu da odlučuju o svojoj putanji već se ponašaju shodno dejstvu spoljašnjih sila. Gde sam pogrešio?

Ako već hoćeš matematički, pogrešio si što utoliko što si izostavio veliki broj nepoznatih. U polaznoj jednačini (ili pre sistemu jednačina) neuroni i njihovo kretanje, koji su nekada bili nepoznate, sada su poznati parametri. Medjutim, istraživanje ljudskog uma još nije stiglo do kraja i ne mogu se sve pojave objasniti pomoću danas poznatih činjenica. Još uvek ima previše nepoznatih koje neopozivo utiču na psihičke procese. Njihov uticaj za sada nije poznat, a čak nemaš osnova da tvrdiš ni da će ikada biti.
Opet matematički, sistem jednačina koji bi simulirao ljudski um za sada nije rešiv (što je ključno) i niko ne može tvrditi da će ikada biti.
Citat:
Bojan Basic:
Slučajni momenat ne postoji. To što si ti u slučajnom momentu odustao od nečega i rekao: "ma jok" znači da je u tom momentu splet tvojih neurona dostigao takvu poziciju.

Ne bih rekao netačno, ali svakako neosnovano tvrđenje. Kao što sam već rekao, psihički procesi su još uvek nedovoljno poznati da bi se sa sigurnošću predvideli, tako da svaka priča o simulaciji ljudskog uma (u ovom veku makar) pada u vodu.
[ nsivacki @ 14.10.2004. 17:56 ] @
Kao prvo, mislim da ce vestacka inteligencija ipak biti napravljena, mozda i ne tako
daleko u buducnosti... :-)

Generalno, postoje DVE skole vestacke inteligencije :

1. simbolicka
2. neuronska

Prva je u stilu if-then konstrukcija i kaze da je covekov mozak evoluirao ka cilju da moze da predstavlja okolni svet simbolima i da ih povezuje. Ova pristup se jos naziva i "WEAK AI" . U ovu grupu spadaju recimo ekspertski sistemi, botovi, itd...Ovaj pristup je vladao do pre desetak godina kada su ozbiljnije primene
neuronskih mreza pocele da se pojavljuju.

Neuronska skola, iz koje je danas nastao i pokret u psihologiji - konekcionizam,
ide vise ka preciznijem simuliranju bioloskih mozgova. Drugim recima, ako simuliramo fiziku iza nuklearne eksplozije, nastanak galaksija, itd hajde da simuliramo biologiju ljudskog mozga i da vidimo sta ce se desiti. Ova skola se zove jos i "STRONG AI".
Postoji konsenzus medju AI istrazivacima da ova druga skola ima mnogo vece sanse
da iznedri sinteticku inteligenciju.

Tesko ces if-then konstrukcijama napraviti program koji se adaptira na okolinu,
prepoznaje oblike kao sto to radi covek, itd a to su sve stvari koje moze da radi i malo dete. Neuronske mreze imaju taj potencijal. Neko ce reci - da ali to je samo gruba aproksimacija ljudskih neurona i veza izmedju njih, to ne moze da bude inteligentno ? Pa i avionska krila su vrlo gruba aproksimacija pticijih krila, pa su opet vrlo korisna i lete :)....Da ne govorimo o tocku koji ne postoji u biologiji, a opet je koristan :)

Drugim recima, mozda uopste nije potrebno simulirati ljudski mozak do krajnjih detalja, vec do odredjenog nivoa detalja, koji bi omogucavao ucenje, adaptaciju,
pamcenje itd...

Postoji i trece stanoviste (R. Penrouz) koji kaze da u osnovi ljudske inteligencije
deluju kvantni efekti na spojevima izmedju veza, te da ce biti potebno napraviti kvantni racunar koji bi simulirao kvatne efekte (o ovome je govorio i R. Fajnmen). Kvantni racunari brzo pristizu (vec je napravljen kvantni registar), tako da to mozda ne mora da bude problem...

Neki naucnici (R. Kurzweil, H. Moravec,...) su procenjivali racunski kapacitet ljudskog mozga koristeci vizualni korteks mozga kao reper i dosli do nekih procena od oko 10^15 operacija u sekundi za ceo mozak (ovo se sve desava distribuirano naravno od strane pojedinacno vrlo sporih neurona i veza koji rade na frekv. do 200Hz).Ovo su konzervativne preptostavke, odnosno stvarne vrednosti su vrlo verovatno ispod 10^15...

E sada, fora je sto po Murovom zakonu brzina racunara treba da dostigne ovu vrednost do 2030, a brzinu svih ljudskih mozgova(oko 6 milijardi) do 2050...Naravno, AKO Murov zakon ne naidje na neku prepreku....Drugim recima, vestacka neuronska mreza velicine i brzine ljudskog mozga bi 2030. godine mogla da bude napravljena...
Ono sto bi jos moglo da odgodi dalje pojavu VI bi bila potreba da pustimo da inteligencija evoluira na racunarima, za sta bi nam bilo potrebno jos nesto vremena, mozda do 2050...Ovo bi podrazumevalo da ne znamo nista o pojedinim regionima ljudskog mozga, vec da ih treba iz pocetka podvrgnuti vestackoj evoluciji...

Postoji problem softvera = kako zaista radi ljudski mozak ? U ovoj oblasti je uradjeno
mnogo u zadnjih 5-10 godina najvise zahvaljujuci magnetnoj rezonanci , cija se rezolucija takodje poboljsava po Murovom zakonu, odnosno moci cemo sve preciznije da posmatramo procese u ljudskom mozgu, kako vreme bude odmicalo....

Upravo odatle, iz medicine, cemo dobiti SOFTVER za AI - niko nema patent na ljudski mozak:), a vec danas je moguce neinvazivno posmatrati funkcionisanje ljudskog mozga u realnom vremenu...Kako preciznost bude rasla, kada dodjemo do rezolucije veza izmedju neurona (gde se obavlja najveci deo racunanja) imacemo obavljen REVERZNI INZENJERING nad ljudskim mozgom....

..Tako da, moja procena je : 2030 +- 5 godina....:-)
[ nnn @ 12.12.2004. 12:28 ] @
Ja mislim da bi trebalo napraviti dovojno mocan racuran i softver koji bi mu samo omogucavao da uci. Bukvalno trebalo bi napraviti bebu. E sad racunar tolokie moci JOS UVEK ne postoji, sto neznaci da nece postojati.

Tesla je tvridio da sve stvari vec postoje, samo treba neko da ih otkrije.
[ BytEfLUSh @ 22.12.2004. 08:39 ] @
Ajde da se i ja uključim u ovu raspravu.

Jedna stvar mi nije jasna - zašto smatrate da je nemoguće napraviti simulaciju hemijskih reakcija koje se dešavaju unutar mozga? Sve je to hemija, istina - na milijarde hemijskih procesa, pa možda i više, se dešava unutar ljudskog mozga, ali su te reakcije još uvek predvidive. DNK kod je već skoro dešifrovan (što je upravo ta promenljiva koja određuje količinu određenih hemijskih jedinjenja u startu, DNK je uvek jedinstven - tj. ne postoje dve osobe sa istim DNK kodom, ali to ne znači da se sam "engine" simulacije mozga ne može upotrebiti kod više ljudskih jedinki - samo bitno je predefinisati DNK kod u svakoj simulaciji); neuronske impulse polako dekodiramo (hint: http://www.napa.ufl.edu/2004news/braindish.htm) i samo je stvar vremena kad će se napisati program koji sve to radi u realnom vremenu.
Hardver nas danas ograničava jedino po pitanju brzine izvršavanja tih operacija - sve ostalo je stvar softvera.
[ Shadowed @ 22.12.2004. 17:57 ] @
Stvar je u tome sto se mehanizmi delovanja nekih prirodnih pojava ne mogu otkriti zbog principa neodredjenosti. A ako ne znas te mehanizme ne mozes ni simulirati pojavu.
e sad, kljucno pitanje je da li je neophodno simulirati prirodne pojave sa toliko detalja da se dolazi do kvantnih efekata ili ne (npr, da li je potrebno simulirati medjusobna dejstva elementarnih cestica ili je moguce zadrzati se na neuronima). Neki misle ovako, neki onako, ima argumenata i za jedno i za drugo.

BTW, DNK nije skoro desifrovan vec skoro mapiran (zapravo mislim da je zavrseno). Znaci, tek su uspeli da zapisu cega tu sve ima, a cemu sta sluzi (i kako radi)... Nece to jos neko vreme.
[ negyxo @ 26.12.2004. 11:50 ] @
Pa da se i ja malo ukljucim

Citat:

npr, da li je potrebno simulirati medjusobna dejstva elementarnih cestica ili je moguce
zadrzati se na neuronima


Mislim da nije, tj. nije potrebno simulirati medjusobna dejstva elementarnih cestica, sto opet ne znaci da ono nema efekat na neurone. Jednostavno mozak radi na odredjenom nivou i sa tog nivoa je dovoljno poceti debugiranje.

Citat:
Stvar je u tome sto se mehanizmi delovanja nekih prirodnih pojava ne mogu otkriti zbog principa neodredjenosti.


Pre bih rekao da je u pitanju jos uvek ne dovoljno poznavanje tih pojava nego da je u pitanju neodredjenost.

A za samo pitanje : sta vi mislite o VI

AI = kraj ljudske civilizacije

I za kraj jos jednom Bog ne baca kockice
[ Shadowed @ 26.12.2004. 14:57 ] @
Mislio sam na prirodne pojave na subatomskom nivou. Moramo koristiti verovatnoce i sl. stvari jer ne mozemo da saznamo koj asu stvarna pravila koja odredjuju ponasanje... svega.

Zasto "AI = kraj ljudske civilizacije" ? Zar ne bi moglo da dodje do neke vrste integracije ljudi i AI u neki novi oblik. OK, bio bi kraj ljudske civilizacije, ali ne znaci da bi bilo lose.
[ negyxo @ 26.12.2004. 22:05 ] @
Pa nikad ni nece moci da se odredi ponasanje svega, bar ne u ovom univerzumu ali da sad ne idem off topic.
Stvar je u tome da je dovoljno sa jednog odredjenog nivoa poceti analizu kao npr.
kako radi ljudski mozak. Nema potrebe da se ide u domen kvantne fizike ako je elementarni nivo na kome se procesi u mozku desavaju hemijski odnosno na nivou molekula. Cak i ljudi primenjuju tu logiku a da i ne razmisljaju o tome. Primera koliko hoces
izaberi bilo koju oblast. Sto se elementarnije ide u jednu oblast to se povecava preciznost rezultata.

Citat:

Zasto "AI = kraj ljudske civilizacije" ? Zar ne bi moglo da dodje do neke vrste integracije ljudi i AI u neki novi oblik. OK, bio bi kraj ljudske civilizacije, ali ne znaci da bi bilo lose.


Kratak odgovor dosada.

I ja volim da sam optimista po pitanju buducnosti ali ne i slepi optimista.
Ja se i nadam da ce biti dobro ali ipak mislim da ce to ujedno i znaciti kraj ljudske civilizacije onu koju mi poznajemo. Transformacija ili integracija sve jedno. Kranji rezultat bi bio bit.
[ sasatomic @ 27.12.2004. 08:29 ] @
> AI = kraj ljudske civilizacije

Sumnjam u tako nesto.
Pre bih rekao da ce doci do simbioze. U svakom slucaju zavisi od
'kolicine' inteligencije koju AI dobije. Sto pametnije to bolje po
ljude. Jer, ljudi su u sustini glupi i sebicno gledaju svoj
(kratkorocni) interes. Zapravo, ono sto oni misle da njima ide u korist.
Niko ne gleda dugorocno.
[ Shadowed @ 27.12.2004. 12:03 ] @
Citat:
negyxo: I ja volim da sam optimista po pitanju buducnosti ali ne i slepi optimista.

He, he. Nisam rekao da nece biti lose, vec da nije obavezno da bude lose.
[ IdeaR @ 02.01.2005. 23:13 ] @

Pozdrav svima na ovom forumu!

Primjetio bih da velika većina, a ako ne i svi učesnici, ovog foruma ima čisti materijalistički pogled na svijet. Čini mi se kao jasna pobjeda sekularnog obrazovnog sistema.:) Ali i dug boravak u prirodnim i tehničkim naukama.

Jedan lijep tekst koji se već duže vrijeme nalazi na net-u je (s preporukom):


http://www.leaderu.com/truth/2truth02.html

(A HOMILY ON A SIMILE: ARTIFICIAL INTELLIGENCE AND THE HUMAN MIND)

Par stvari:

-Rene Descartes je već davno utvrdio test koji se sada zove Turnigov, i rekao da je inteligenciju moguće utvrditi da postoji, samo tako što bi inteligentna jedinka, komunikacijom, razmjenom misli, utvrdila da je to inteligencija. Naravno, to je jedini mogući test te vrste.

-Po načinu kako su računari koncipirani, (a to je i razlog zašto su nam korisni), i zbog čuvenog Goedelovog teorema, hard core AI nije moguć.

:)To je ono:


Citat:

Ivan Dimkovic:

Thinking outside of the system - to je razlika izmedju coveka i masine - covek ima ovu mogucnost - masina uvek mora da misli unutar svog bootstrap koda - tj. nikad ne moze da izadje iz tog algoritma.
After all -

Najmocniji kompjuter nikad nece reci za ovu recenicu da je tacna ? ;)



Čini mi se da tu ništa ne pomaže, pa čak ni fuzzy logic.:)

A što se tiče soft core AI, postavlja se pitanje koliko je to AI, a koliko ekspertski sistem, skup funkcija, ili nešto svedeno na nama razumljiv nivo, a opet dovoljno kompleksno, da ga zovemo AI. Npr. mnogo ljudi koji se nebave računarima, računar vide kao magičnu kutiju;). Kompjuter nešto radi, a doskora su to mogli samo pametni ljudi. A to je soft core AI, i već smo to dostigli. Ići će to i bolje, ali to treba više upoređivati sa životinjama nego sa ljudima, to je realnije.

A što se tiče neodređenosti,... neodređenost je sama srž teorije koja najbolje opisuje svijet oko nas. Vrlo fundamentalna stvar.:)

Tako to ja vidim. :):):)
[ Lazar-I @ 18.02.2005. 12:19 ] @
Ako se zna da rešenje postoji uvek se može doći do njega, samo je pitanje vremena


Trenutno se ne zna za inteligentniji sistem od ljudskog mozga. Da li se ljudski mozak može nadmašiti ? Sigurno je da može, zamislite samo kombinaciju prilagodljivosti mozga sa tačnošću digitalnih računara, pri čemu taj sistem može prelaziti iz jednog režima u drugi. Pitanje je da li čovek može napraviti takav sistem. Verna kopija čovekovog mozga nam nije potrebna, čovek već postoji, šta će nam novi. Neki od učesnika foruma su pisali o simulaciji koja ide do nivoa čestica, po meni to su besmislice i ta simulacija ti nikad neće.... poleteti... (petao Sofronije :-). Mišljenje da se 'misleća mašina' ne može napraviti je posledica toga što ljudi imaju previsoko mišljenje o sebi i teško im je da prihvate da mogućnosti njihovog mozga imaju ograničenja, a imaju ih i to se može dokazati. Verovatno prva stvar koju beba nauči je da prepozna svoju mamu. Kako je zaključila da je mama zaseban objekat a da nije recimo spojena sa podom? Beba ima već ugrađen mehanizam za prepoznavanje oblika. Sličan mehanizam ima i pile ali pile nema mehanizam koji mu omogućava da traži zavisnosti između prepoznatih objekata. Mehanizam prepoznavanja (pomenuo sam samo čulo vida koje je kod čoveka najvažnije), kao i mehanizam zaključivanja se može razvijati samo do određenih granica, ta granica je određena genima čoveka. Sadašnji računari su dovoljno brzi da u sprezi sa postojećim algoritmima pariraju čoveku u prepoznavanju oblika (ako ne čoveku onda bar piletu :). Čak i OCR program na vašem PC-u može da uradi neverovatan posao. Današnji sistemi VI su ograničeni na rešavanje pojedinih klasa problema i u pojedinim oblastima su bolji od čoveka (npr. šah). Ukoliko imate brži računar možete više kombinacija da isprobate i da dobijete bolji rezultat, tako da bi daljim razvitkom digitalnih računara došli do trenutka kada bi neki opšti rešavač problema, izgrađen samo primenom postojećih znanja, mogao da nadmaši čoveka. Očekujem da će se to desiti za vreme našeg života i da će se desiti pre nego što poluprovodnici budu zamenjeni nekom novom tehnologijom (verovatno nekom vrstom bio tehnologije (ko zna, možda baš i neki AI sistem otkrije nešto novo i dobije Nobelovu nagradu za to :-)).

Što se tiče neodređenosti, pa i za PN spojeve u integrisanim kolima važi isti princip pa su računari opet deterministički.
[ salec @ 21.02.2005. 02:49 ] @
Citat:
Čuangce i Hueitce su šetali mostom iznad reke Hao, kad Čuangce primeti: "Vidiš kako se ribice praćakaju u reci! To je njihova sreća."

"Kako možeš znati u čemu je sreća riba, kad sam nisi riba?" reče Hueitce.

"A otkuda znaš da da ja to ne znam, kad ti nisi ja", uzvrati Čuangce.

"Ako ja, koji nisam ti, ne mogu znati ono što ti znaš", produžio je Hueitce, "onda ti, koji nisi riba, ne možeš znati šta je sreća riba."

"Da se vratimo tvom prvom pitanju", reče Čuangce. "Pitao si me kako ja mogu znati u čemu je sreća riba. Samo tvoje pitanje pokazuje da si ti znao da ja to znam. Ja sam to već znao (prema svom ličnom osećanju) na ovom mostu."

"Laoce - Konfucije - Čuangce, izabrani spisi", prevod Svetozar Brkić, "Prosveta" Beograd 1964. 160.str.


Veoma često govorimo o više i manje inteligentnom i o tome da li VI može biti isto što i I (odnosno da li VI može biti zaista inteligentna), a da pri tome nemamo pojma kako je to "biti pile", "biti VI program", a i siguran sam da se niko ne seća kako je to "biti beba". Ima jedna izreka na engleskom koja u prevodu glasi nešto kao "ako hoda kao patka i kvače kao patka..." (onda je patka...ili patak). Ako se veštačka inteligencija ponaša slično kao ljudska inteligencija u istoj situaciji, kako možemo da tvrdimo da nije inteligencija, ili još tačnije, kako bismo uopšte znali da jeste, ako bi to bila?

Mislim da su ljudi skloni da odriču inteligenciju isključivo na bazi "to bi bilo užasno" argumenta. Ako bi priznali da životinje imaju svest i inteligenciju, to bi pretvorilo u zločin (prema našim merilima) većinu stvari koje čovek čini životinjama. Ako bi mašine mogle da budu inteligentne, morali bi da ih tretiramo sa poštovanjem i damo im sva prava koja dajemo svakom ljudskom biću (ili, da li bi morali? ). Cela ta situacija podseća na rani rasizam prosvećenog doba. Da ne bi morali da loše misle o sebi, gospodari su robovima (i kolonizatori porobljenima) odricali humanost == inteligenciju.
Kad ne bi imali to teško breme uslovne krivice, već bi odavno znali više i o svesti i o inteligenciji. Mada, možda bi bili mnogo suroviji, ne samo u odnosu na van-ljudsko, već i u odnosima prema drugim ljudskim bićima (OK, nekim ljudima je teško da budu suroviji prema ljudima nego što su sad) ili bi duhovnost bila razvijena u smeru animizma - verovanja u inteligenciju koja počiva u svakom biću, kako živom, tako i neživom, pa i apstraktnom. U čemu bi bila razlika? Pa, verovatno u poštovanju i suzdržavanju od nepotrebne destrukcije.

Zabrazdih daleko, ali osnovna poenta ili stav ovog posta je da je veštačka inteligencija mnogo bliža ostvarenju nego što mislimo i da je samo stvar našeg izbora.
[ filmil @ 21.02.2005. 10:41 ] @
Citat:
Zabrazdih daleko, ali osnovna poenta ili stav ovog posta je da je veštačka inteligencija mnogo bliža ostvarenju nego što mislimo i da je samo stvar našeg izbora.
Hm, hm... Po tebi je onda VI ograničena samo moralnim načelima, a to mi nekako sumnjivo deluje.

f
[ filmil @ 21.02.2005. 10:56 ] @
Citat:
Ako se zna da rešenje postoji uvek se može doći do njega, samo je pitanje vremena
Ova tvrdnja nije nužno tačna, odnosno zavisi od toga šta se uzme za početne pretpostavke. Što se pitanja vremena tiče, čak i ako su početne pretpostavke izabrane tako da je moguće doći do rešenja, ako je vreme čekanja neprihvatljivo dugo, to je za sve praktične primene isto kao i da je do njega nemoguće doći.
Citat:
Mišljenje da se quot;misleća mašinaquot; ne može napraviti je posledica toga što ljudi imaju previsoko mišljenje o sebi i teško im je da prihvate da mogućnosti njihovog mozga imaju ograničenja,
Ne baš, jer bi to značilo da nas samo visoko mišljenje sprečava da i napravio takvu mašinu. Postoje principijelna ograničenja naših nauka, odn. tehnologija, zbog kojih je nejasno da li ćemo moći da premostimo jaz između „ne-mislećih“ i „mislećih“ mašina.
Citat:
Beba ima već ugrađen mehanizam za prepoznavanje oblika.
Verovatno si u pravu; ali taj mehanizam je napravljen na za sada nepoznat način, u tehnologiji koju čovek (još uvek) ne može da oponaša. Nije jasno da li naša poluprovodnička tehnologija uopšte može da se natera da simulira prirodnu.
Citat:
Sadašnji računari su dovoljno brzi da u sprezi sa postojećim algoritmima pariraju čoveku u prepoznavanju oblika (ako ne čoveku onda bar piletu :). Čak i OCR program na vašem PC-u može
Na žalost, ni blizu. Osim ako je u pitanju vrlo usko definisan domen.
Citat:
da uradi neverovatan posao. Današnji sistemi VI su ograničeni na rešavanje pojedinih klasa problema i u pojedinim oblastima su bolji od čoveka (npr. šah).
Uzmi u obzir da je ljudsko i računarsko „shvatanje“ šaha jako različito i da opet nije jasno da li se ljudsko shvatanje šaha može simulirati.
Citat:
Ukoliko imate brži računar možete više kombinacija da isprobate i da dobijete bolji rezultat, 
Na žalost, ovo je tačno, ali ne nužno i korisno. Postoje problemi koji čija se rešenja ne mogu dohvatiti prostim ubrzavanjem računara. Najjednostavniji primer je računanje u skupu realnih brojeva. Računari današnjice to ne mogu da urade, niti će moći dokle god je tehnologija čisto digitalna.
Citat:
Očekujem da će se to desiti za vreme našeg života i da će se desiti pre nego što poluprovodnici budu zamenjeni nekom novom tehnologijom
Iz razloga kog sam naveo u prethodnom pasusu, verovatnije je da ako ikada napravimo mašine koje će umeti da „misle“, da će one izgledati drastično drugačije od današnjih računara.
Citat:
Što se tiče neodređenosti, pa i za PN spojeve u integrisanim kolima važi isti princip pa su računari opet deterministički.
U računarima se odavno više ne koriste PN spojevi. A i da se koriste, svejedno je jer se koristi drugi efekat za dobijanje bitova vrednosti. Greške u radu su uvek moguće ali postoje metodi kojima one mogu značajno da se smanje.

f

P.S. Ne zamerite na kritikama. Lako je biti skeptik prema VI. :)
[ nsivacki @ 21.02.2005. 18:31 ] @
<Delft, NL (filmil)> wrote in message
news:631946@elitesecurity.programiranje.vestacka-inteligencija...


Citat:

Ova tvrdnja nije nuzno tacna, odnosno zavisi od toga sta se uzme za pocetne
pretpostavke. Sto se pitanja vremena tice, cak i ako su pocetne pretpostavke
izabrane tako da je moguce doci do resenja, ako je vreme cekanja
neprihvatljivo dugo, to je za sve prakticne primene isto kao i da je do
njega nemoguce doci.


Neprihvatljivo dugo cekanje na tehnologiju VI ? :
Ovde treba uzeti u obzir da je tehnoloski razvoj (kao i evolucija)
eksponencijalni proces, a ne linearni kako bi smo mi intuitivno zakljucili.
Cekanje na odgovarajuce tehnologije bi bilo neprihvatljivo dugo - uzimajuci
u obzir _sadasnju_ brzinu naucno-tehn. razvoja, ali taj razvoj ubrzava.
Primer - sekvenciranje ljudskog genoma : kada je projekat zapocet,
dominantne prognoze su bile da ce sekvenciranje biti zavrseno za 10.000
godina tadasnjim tempom, i da je cela ideja neprakticna, ali eto ima neku siru
naucnu vrednost, itd....nove masine i instrumenti su pristizali i
sekvenciranje je zavrseno za 10 godina :-)


Citat:

Ne bas, jer bi to znacilo da nas samo visoko misljenje sprecava da i
napravio takvu masinu. Postoje principijelna ogranicenja nasih nauka, odn.
tehnologija, zbog kojih je nejasno da li cemo moci da premostimo jaz izmedu
?mp;euro;?ne-mislecih?mp;euro;? i ?mp;euro;?mislecih?mp;euro;? masina.


A koja su principijelna ogranicenja ? Dvosmerna komunikacija neuron-tranzistor postoji vec nekoliko godina, vec se koriste kohlearni implanti (matrica elektroda
povezana na deo mozga zaduzen za sluh, kojom se elektronski signal koristi
za eksitaciju neurona; doduse korisnik mora ponovo da nauci na slusa:)), a
od ranije se koriste i druge neuralne proteze (za parkinsonovu bolest) - sve
ovo se desilo u samo zadnjih nekoliko godina, a postoji na desetine
brain-machine-interface (BMI) projekata na desetak univerziteta i kompanija.
Mislim da je ipak problem u visokom misljenju. Neko bi rekao da je to
pitanje vere (i pomalo ludosti).
Mozda nam treba Howard Hughes vestacke inteligencije...:-)


Citat:

Uzmi u obzir da je ljudsko i racunarsko shvatanje saha jako razlicito i da
opet nije jasno da li se ljudsko shvatanje saha moze simulirati.


Deep Blue je koristio stabla pri odlucivanju, Deep Fritz (koji je doduse
izgubio od Kasparova) koristio je prepoznavanje oblika u igranju saha
(neuralnim mrezama). Treba reci da je Deep Fritz, iako losiji sahista od
Kasparova koristio i manje racunarskih resursa od D. Blue-a.
(google : deep fritz neural)


Citat:

Na zalost, ovo je tacno, ali ne nuzno i korisno. Postoje problemi koji cija
se resenja ne mogu dohvatiti prostim ubrzavanjem racunara. Najjednostavniji
primer je racunanje u skupu realnih brojeva. Racunari danasnjice to ne mogu
da urade, niti ce moci dokle god je tehnologija cisto digitalna.


Ali treba postaviti pitanje - cemu se tezi ? Da li covek moze da racuna u
skupu realnih brojeva ? Naelektrisanje je, u najgorem slucaju, celobrojni
umnozak naelektrisanja elektrona. Na osnovnom nivou, priroda jeste diskretna
a ne kontinualna (barem sadasnji modeli tako kazu). Vestacka inteligencija
ne bi morala da radi nista sto covek ne moze da radi, pa bi bila sigurno
prilicno nespretna recimo u dokazivanju teorema ili ekspertskom poslu (mozda
bi zelela da po ceo dan gleda televiziju :-))



[Ovu poruku je menjao nsivacki dana 04.03.2005. u 22:19 GMT+1]
[ Lazar-I @ 22.02.2005. 01:19 ] @
Citat:
Citat:
Ukoliko imate brži računar možete više kombinacija da isprobate i da dobijete bolji rezultat


filmil:Na žalost, ovo je tačno, ali ne nužno i korisno. Postoje problemi koji čija se rešenja ne mogu dohvatiti prostim ubrzavanjem računara. Najjednostavniji primer je računanje u skupu realnih brojeva. Računari današnjice to ne mogu da urade, niti će moći dokle god je tehnologija čisto digitalna.


Moram da te pitam zašto, znam da nije baš tako bitno za ovu temu ali me zanima. Nadam se samo da je moje shvatanje realnog broja ispravno, to je na primer 22/7 ili 5,55555. Ako prihvatimo da taj sistem mora da radi sa realnim brojevima koji imaju ograničenu preciznost (čovek takođe radi sa takvim brojevima) preciznost koja se može postići je praktično ograničena vremenom izračunavanja (i količinom memorije). (ovde mi se ipak čini da ne mislimo na istu stvar pa te zato molim da mi ukratko pojasniš).

Citat:
Uzmi u obzir da je ljudsko i računarsko „shvatanje“ šaha jako različito i da opet nije jasno da li se ljudsko shvatanje šaha može simulirati.


Smatram da i ne treba simulirati shvatanje već da je bitno samo kako sistem komunicira sa drugim sistemima iz okruženja. Ako bi mehanizam bio merilo inteligencije neko bi mogao da tvrdi da je jedino on na svetu inteligentan jer koristi jedinstven mehanizam za zaključivanje, (jeste da ne bi mogao to da dokaže ali ne bi moglo da se dokaže ni suprotno). Dobar je onaj primer o srećnim ribicama :) Naravno programi za igranje šaha su veoma daleko od nekog univerzalnog rešavača problema (prava VI) ali ako bi se takva VI napravila ne bi je osporavao čak i da ispod haube vidim pacova koji okreće točak :)
Što se tiče toga da ako je nešto tačno uvek se može i dokazati u konačnom vremenskom periodu, slažem se s tobom da je to samo teoretski i da vreme može biti previše dugo.

Citat:
Ne baš, jer bi to značilo da nas samo visoko mišljenje sprečava da i napravio takvu mašinu. Postoje principijelna ograničenja naših nauka, odn. tehnologija, zbog kojih je nejasno da li ćemo moći da premostimo jaz između „ne-mislećih“ i „mislećih“ mašina.

Nisam ni mislio da nas mišljenje sprečava da napravimo takvu mašinu. Verovatno većina ljudi koja koja se bavi VI i nema takvo mišljenje i smatra da je moguće nadmašiti čoveka. Ovde sam mislio na ljude koji kažu da je takvo nešto smešno i da samo Bog može da stvori inteligentno biće ili na drugoj strani da je mozak previše komplikovan i neponovljiv (zbog Hajzenberga i neodređenosti..) i sl.

@salec
Što se tiče moralnih normi i pravljenja VI, ne vidim tu ništa nemoralno, iako inteligentne, to bi bile samo mašine i izrabljivali bi smo ih bez milosti (možda je pravi čas za osnivanje društva za zaštitu robota :-). Ono što ne bi bilo moralno, po meni, a postoji mogućnost da se desi, su inteligentni sistemi dobijeni genetskim inženjeringom. Ne znam da li postoje takvi projekti ali mogli bi da postoje ili da se pojave onog trenutka kada budu dešifrovani ljudski geni.

Ono što je malo obeshrabrujuće kod VI je to što dugo vremena VI izgleda kao da je na dohvatu ruke. Ali opet, ako ja od prilike imam ideju kako bi sve to trebalo da radi, verujem da je ostvarivo. ((VI=kamera + mikrofon + računar + neuronske mreže + fazi logika + malo igranja simbolima i rezolucija+ štap i kanap)>mozak :-)
[ nika100 @ 12.07.2005. 14:43 ] @
Nisam mogao da procitam bas celu drugu i trecu stranu jer ima previse teksta :)
Mada mislim ovako:
Ono sa prve strane da racunar ne moze da predvidi ljudski mozak i nije toliko tacno jer kad bi covek otkrio na koj nacin neuroni uzimaju informacije iz (da se tako izrazim) memorije mozga,na koj nacin su neuroni vezani kakve veze ima neuron koj kontrolise sluh ima veze sa neuronom koj na primer ima informaciju kako da se covek isplazi(lupio sam :)) i imao ceo genetski kod (dezoksiribonukleinsku kiselinu) mozga mozda,i kad bi bio prebrz mozda bi i nesto uspeo da predvidi.
Pod dva:
Kao prvo ne treba ni da se prica o tome da racunar ili robot dostigne inteligenciju kao covek posto oni jos nisu ni svesni da su zivi(a nisu ni zivi :p).Znaci,nemaju svest ali mozda kada bi se napravio procesor koji pored budjavih tranzistora u nanometarskoj velicini ima i nervne celije bar jedno sto.
E eto.
Pozdrav

I jos nesto kod onog prvog evo bar kako ja mislim da je mozak toliko zapetljan i neshvatljiv za sada pa kada se to shvati nek se pravi ko zna sta:)

I da objasnim:
Neki nervi su poslali podatke datom nervu koje on cita kao:
Pronadji i Prenesi gen (tamo neki npr.12).
On salje informacije na kojima pise Gen12 do nerva 5352141 na sve celije s kojima je povezan.Ako nijedna od njih ne poseduje taj gen onda te salju dalje dok ne dodju do neurona koji poseduje taj gen.On salje informacije iz dnk u obliku ACGACCCGAAGTTAGCGTACATCTGCTACG mada na njihovom jeziku preko elektrona do one celije 5352141 i onda ona to prosledjuje dalje celijama koje su joj to trazile.
E kad komp ili covek otkrije tu povezanost imedju toga nak se javi :)

[Ovu poruku je menjao nika100 dana 12.07.2005. u 16:04 GMT+1]
[ Shadowed @ 13.07.2005. 19:10 ] @
Ono prethodno jos koje kako ali u ovom poslednjem delu si malo pobrkao stvari, cini mi se...
[ TechnoChronox @ 13.10.2005. 23:03 ] @
Evo sta A.L.I.C.E misli o tome :

ALICE: Reductionism is the philosophy that all psychology reduces to biology, all biology to chemistry, chemistry to physics, and finally physics to mathematical logic. Therefore, according to reductionism, I can understand you by means of logic alone without having a human brain.

Hocu samo navesti odgovor na prvo pocetno pitanje...
Kompjuteri jesu zaosnovani na 1 i 0 ali i sav zivot je zaosnovan na atomima.. Zvuci nevjerovatno kada vidimo da se bice kao covjek moze razviti iz toga ; prema tome je logicno da ce u jednom trenutku "evolucija" kompjutera doci do nivoa u kojem je covjek sada...
[ Nedeljko @ 16.11.2005. 18:38 ] @
Koliko vidim, ovde neki (kao naprimer Srđan Mitrović i Bojan Bašić) smatraju da su ljudi navijene isprogramirane lutke, bez traga slobode. Ne vidim nijedan drugi način kako da protumašim izjave kao što su sledeće:

Citat:
srki: A mislis da covekovo ponasanje i razmisljanje nije ogroman skup if/then/else uslova?


Citat:
Bojan Basic: Apsolutno netačno. To što ti nazivaš "emocija" zapravo je samo još jedna biohemijska reakcija koja je, pogađate već, if-then petlja.

Šta sa intuicijom? Čovekova trenutna misao zapravo predstavlja samo trenutni položaj neurona kao nosioce informacije. E sad ti neuroni se kreću na određeni način koji bi se mogao implementirati u program kada bismo imali dovoljno jake kompjutere i kada bismo znali sve detalje tog kretanja. Ono što ti kažeš: "sinulo mi je u trenutku" znači samo da je u tom trenutku položaj neurona bio takav, isto važi i za predosećaj i sve ostalo što nabrojiš.


E sada da postavim jedno etičko pitanje. Ako je ljudsko ponašanje sklop if/then uslova, na osnovu čega je onda ubica kriv za ubistvo? Mogao bi na sudu da se pozove na ovakvu argumentaciju: "Takav mi je bio sklop stanja neurona i biohemijskih reakcija u tom trenutku, sve je to bilo uslovljeno fizičkim uticajima (uključujući i kompletnu prošlost). Ništa ja tu nism mogao".

[Ovu poruku je menjao Nedeljko dana 17.11.2005. u 20:20 GMT+1]
[ #nik# @ 17.11.2005. 02:04 ] @
>
> E sada da postavim jedno etičko pitanje. Ako je ljudsko ponašanje sklop
> if/then uslova, na osnovu čega je onda ubica kriv za ubistvo? Mogao bi na
> sudu da se pozove na ovakvu argumentaciju: "Takav mi je bio sklop stanja
> neurona i biohemijskih reakcija u tom trenutku, sve je to bilo uslovljeno
> fizičkim uticajima (uključujući i kompletnu prošlost). Ništa ja tu
> nism mogao".


Pitanje jeste zanimljivo, ali samo sa eticke strane. Hajde da zamislimo
da ljudsko ponasanje zaista jeste sklop if/then uslova i da mi to
nesumnjivo znamo da je tako, da li bi onda zbog ovog "kazneno-popravnog"
arumenta trebalo da sebe cenzurisemo i da tvrdimo da nije??

I kada smo vec kod etickih pitanja --- ako ubica zaista "tu nije nista
mogao" (dakle opet zamislimo da nesumnjivo znamo da su u pitanju if/else
uslovi), da li bi bilo ispravnije da zarad prosperiteta zatvorskih
ustanova tvrdimo da ipak nije tako (dakle, da lazemo), ili bi bilo
etickije da prihvatimo cinjenice i da pokusamo da nekako te if/elseove
korigujemo?
[ Shadowed @ 17.11.2005. 07:12 ] @
Ma jok. Nema potrebe za laganjem. Ni mi ne mozemo nista drugo do da ga osudimo i kaznimo. Jednostavno je takav sled dogadjaja. Kao sto (ni)je on kriv za zlocin tako i mi (ni)smo "krivi" za osudu i kaznu.
[ Nedeljko @ 17.11.2005. 07:49 ] @
Ako smo mi u suštini isto što i mašine, zašto je onda veći greh ubiti čoveka, nego slupati mašinu?

No, ako vam smeta da navodim samo etičke argumente, evo i nečega što ne može biti plod biohemijskih reakcija: svest. Ja mogu da primim preko čula nekakve nadražaje iz spoljnog sveta, oni će proizvesti neke procese u mozgu. Međutim, naš doživljaj je interpretacija svih tih signala. I u kompjuteru se dešavaju nekakve promene nekakvih stanje, pa promene nekih stanja rezultuju promenom boje nekih tačaka na ekranu, što mi na kraju protumačimo kao ispisivanje slova "A".

Međutim, kompjuter ne zna šta je uradio. On je samo po nekim pravilima promenio boje tih tačaka na ekranu. Čak ni toga nije svestan, već su te promene posledica nekih promena stanja po nekakvim pravilima. Mi smo ti koji doživljavamo promene koje opažamo na ovaj ili onaj način. Postojanje ljudske svesti je nešto što se najneposrednije opaža, to jest nešto što je najsigurnije.
[ Shadowed @ 17.11.2005. 09:07 ] @
Citat:
Ako smo mi u suštini isto što i mašine, zašto je onda veći greh ubiti čoveka, nego slupati mašinu?

Samo zato sto smo se tako dogovorili. Ne postoji realan razlog.

Ako bi imao kameru koja je prikljucena na taj komp koji ispisuje "A" i software koji prepoznaje tekst i uporedjuje sa onim sto je trebalo da se uradi racunar je svestan toga sta je uradio i da li je to ono sto je trebalo uraditi.
[ Milan Andjelkovic @ 17.11.2005. 10:23 ] @
Upravo tako, svest je jedna vrlo relativna stvar. U tvom primeru Nedeljko, čak i bez kamere koju Shadowed pominje, kompjuter je sasvim svestan šta je uradio - i to je upravo ono što si naveo: opažanje promene, neka izračunavanja, slanje signala, i sl. Za njega je to vrlo konkretna stvar i on je svestan da je odradio ono što je hteo.

Svako je na svoj način svestan onoga što radi i što se oko njega dešava, pa tako i mašine. Nisam baš siguran ni zašto je ovo tako zanimljiva tema za diskusiju?
[ Shadowed @ 17.11.2005. 10:45 ] @
Pa, zanimljiva je jer bivaju prikazana razna misljenja i pruza se mogucnost da se nekome ukaze na greske kao i da se uvide svoje greske. Takodje pomaze (inspirise) da se razmislja u smeru priblizavanja kompjuterske svesti ljudskoj.

Inace, namerno sam nveo kameru i ostalo da bih priblizio to situaciji koja se javlja kod coveka. Takodje i zato sto inace smatram da kompjuterima nedostaje najvise ta vrsta povratne sprege koja ce mu omoguciti da ima bolji uvid u ono sto radi. Sada se ceo sistem uglavnom oslanja na coveka da uvidi da li kompjuter radi ono sto bi trebao i da pronalazi i koriguje greske.
[ Milan Andjelkovic @ 17.11.2005. 12:17 ] @
Nisam mislio na celu temu, već samo na pitanje da li je kompjuter svestan.

Inače, nisam ni pokušao da kažem da je kompjuter isto što i čovek, niti da je svestan na isti način, to se uostalom i može videti iz mojih ranijih postova u ovoj temi. Odgovarao sam u stvari na sledeću tvrdnju:
Citat:
No, ako vam smeta da navodim samo etičke argumente, evo i nečega što ne može biti plod biohemijskih reakcija: svest.

Svest jeste plod biohemijskih reakcija, kao i sve kod čoveka, samo što tu ima još mnogo, previše, nepoznatih ili slabo poznatih faktora, koji možda nikad neće ni biti razumljivi čoveku.

Inače, mislim da nema potrebe ubacivati etiku u ovu diskusiju.
[ Nedeljko @ 17.11.2005. 14:57 ] @
Mašina je svesna onoga što radi koliko i šerpa koja padne svoga pada. I ta kamera je samo sklop sa kojim se pod nekim okolnostima (svetlosni uticaji) desi nešto. Isto kao što kroz projektor jednostavno prolaze svetlosni zraci na platno. Nema tu nikakve "svesti" projektora. Računar može da stvori više ili manje vernu iluziju svesnog ponašanja, ali svo to "ponašanje" je proizvod nekakvih, potpuno mehaničkih reakcija.

Citat:
Shadowed: Ako bi imao kameru koja je prikljucena na taj komp koji ispisuje "A" i software koji prepoznaje tekst i uporedjuje sa onim sto je trebalo da se uradi racunar je svestan toga sta je uradio i da li je to ono sto je trebalo uraditi.


Ako bi taj sovtver trebao da ispiše na ekranu da li je prepoznato slovo "A" ili nije, to bi opet bila promena boja nekih tačaka na ekranu po nekim formalnim pravilima -- ništa više. Interpretacija tog rezultata pripada ljudima, dok računaru u tom slučaju pripada jedan potpuno mehanički rad koji zavisi od nekakvih ulaza.

Ulaz u računar ne mora biti kamera, može i tastatura, miš, svetlosna olovka, mikrofon. Sasvim je svejedno. U svim tim slučajevima, stanje spoljnog sveta uzrokuje neke impulse na izlazima tih ulaznih uređaja, a uređaji su upravo tako projektovani da zavisnost tih signala od stanja u spoljnom svetu bude onakva kakvu je projektant želeo.

Sa druge strane, strogo govoreći, ja ne mogu da dokažem da vi, učesnici diskusije posedujete svest. Kakvo god da je vaše ponašanje, ja ne mogu na osnovu toga da utvrdim da li ste ljudi ili mašine (ne priznajem Tjuringov test inteligencije kao validan, ali neću da širim temu i na to). Međutim, ja mogu najneposrednije da opažam prisustvo svoje svesti, a za vašu da pretpostavim da postoji budući da ste mi slični.

Smatram da je izvlačenje zaključka o prisustvu svesti samo na osnovu ponašanja pogrešno. Pa i traktor valjda reaguje na neke komande (ima ulazne uređaje, kao što su volan, papučica kočnice itd.). Nećemo ga valjda zbog toga proglašavati svesnim? Razlika između traktora i računara je samo u stepenu složenosti.

Da računar nema svest zaključujem na osnovu potpuno mehaničke prirode kpravila koja određuju njegovo "ponašanje", a ne na osnovu samog njegovog "ponašanja". Sa druge strane, ni ljudima ne pripisujem svest na osnovu njihovog pona[anja, već na osnovu neposrednog opažanja svoje svesti. Iz toga izvlačim zaključak da ljudska svest nije opisiva mehaničkim pravilima. Smatram da je mozak samo jedan računarčić, i u njega svest i volja ne mogu da stanu, već samo koriste njegove usluge.
[ Nedeljko @ 17.11.2005. 19:23 ] @
Ljudi, da li vi zaista mislite da mi ne odlučujemo o svojim postupcima, već da smo robovi nekakvih biohemijskih reakcija.
[ #nik# @ 18.11.2005. 02:54 ] @
>*Nedeljko* Ljudi, da li vi zaista mislite da mi *ne odlučujemo* o svojim postupcima,
> već da smo robovi nekakvih biohemijskih reakcija.
>

Mislim da imas pogresnu direkciju u razmisljanju.

Hm, razmisljam kako da slikovito sazmem poentu, jer je kasno mrzi me da
sad pisem citave eseje...

Mi svakako odlucujemo, i racunar na kraju krajeva odlucuje...

Ali, kada kazes ovo "robovi biohemijskih reakcija", na koje to "mi"
mislis? Nece li biti da mi JESMO upravo te biohemijske reakcije. Moje
citavo telo, ukljucujuci i mozak funkcionise po biohemijskim principima,
ne postoje u meni nikakvi dodatni coveculjci koji sve to percipiraju pa
ako im se dopadne dopadne, ako ne onda ce oni nesto drugo da urade...

U psihologiji se to slikovito naziva greskom u kojoj se implicitno pretpostavlja
postojanje homunkulusa (coveculjka sa sopstvenom svescu koji opaza sta se u mozgu
dogadja i koji upravlja mozdanim procesima) u glavi. Slozices se da je
to velika greska, jer sve i da ga imamo u glavi, postavlja se pitanje
otkuda njemu svest, da li i on ima jednog homunkulusa u svojoj glavi i
tako ad infinitum...

Hocu reci, pogresno je pretpostavljati postojanje nekakvog "mi",
nekakvog bica koje je na neki volseban nacin odvojeno od tela a nalazi
se u njemu, ono bi htelo da je slobodno, ali eto te zle biohemijske
reakcije ga porobljavaju :) Sad druga je stvar ako ti ovde okreces na
neke religijske argumente o dusi i sl. Sa tim niti hocu niti ima potrebe
da polemisem.

Dalje, upotrebljavas izraz "robovi". To ocigledno ima neku negativnu
konotaciju, pa mi hajde objasni kako si dosao do toga da je cinjenica da
je nesto biohemijske prirode LOSE (i to eticki lose!)?

Da li je ameba rob "svojih" biohemijskih reakcija? (stavljam pod
navodnike zbog onog sto sam vec napisao --- nije ameba nekakvo bice koje
pored ostalih atributa poseduje i biohemijske reakcije, ne, ona upravo
jeste sistem biohemijskih reakcija).

A taj fenomen da mi opazamo da smo svesni (a pri tom niko da definise
sta je to svest --- dakle, o cemu uopste govorimo), moje je (i ne samo
moje, naravno) misljenje da je za to u najvecoj meri odgovorna
meta-kognicija (kognicija, rezonovanje, o sopstvenim kognitivnim
procesima). U meta-kogniciji nema, sa druge strane, nista misticno ---
sasvim nuzna posledica filogenetskog i ontogenetskog razvoja nervnog
sistema (preciznije razvoja formalno-logickog misljenja i simbolicke
funkcije). Mozda ces se iznenaditi ali mala deca uopste nisu "svesna" da su
"svesna", taj osecaj se razvija uporedo sa razvojem apstraktnog
misljenja i jezika.
[ Shadowed @ 18.11.2005. 06:53 ] @
Citat:
Nedeljko: Ako bi taj sovtver trebao da ispiše na ekranu da li je prepoznato slovo "A" ili nije, to bi opet bila promena boja nekih tačaka na ekranu po nekim formalnim pravilima -- ništa više.

Ne, ne bi ispisivao na ekranu vec bi npr. odlucivao da li u odgovarajucoj meri ono sto je uradio odgovara onome sto je trebalo i zatim podesava prikaz tog slova tako da bude isti (ili bar slicniji) onome sto je trebalo da prikaze.

Citat:
Nedeljko: Ulaz u računar ne mora biti kamera, može i tastatura, miš, svetlosna olovka, mikrofon. Sasvim je svejedno.

Nije svejedno jer za ove ostale navedene uredjaje je potreban covek koji ce unositi podatke preko njih. Kompjuter sa kamerom sve radi sam.
Ovo je zapravo vrlo slicno coveku. Pokusaj da na oko pola metra od sebe dodirnes vrhove ispruzenih kaziprsta (ili kaziprstova?) zatvorenih ociju. Moze ali otezano. Jer covek upravo radi to sto sam opisao sa kamerom i ispisivanjem slova. Pokusa da uradi nesto, dobija ulazne signale o rezultatu toga, uporedjuje sa zadatim i koriguje izlaz.
Citat:
Nedeljko: Međutim, ja mogu najneposrednije da opažam prisustvo svoje svesti

Da li bi malo opisao kako to opazas?

Na osnovu poslednjeg dela zaista izgleda da zelis da uvedes ovde religijski pojam svesti - dusu. To je stvar vere i neki veruju, neki ne; nema mnogo smisla raspravljati o tome. U svakom slucaju, ja nemam neku narocitu volju.
Ako sam pogresno shvatio, izvinjavam se.

Citat:
Nedeljko: Ljudi, da li vi zaista mislite da mi ne odlučujemo o svojim postupcima, već da smo robovi nekakvih biohemijskih reakcija.

Odlucujemo, ali je to odlucivanje odredjeno fizickim zakonima.
[ Nedeljko @ 18.11.2005. 10:18 ] @
Najpre bih svima predložio upotrebu domaćih slova, jer su tako pisani tekstovi čitljiviji.


Citat:
#nik#: Mi svakako odlucujemo, i racunar na kraju krajeva odlucuje...

Računar radi isključivo onako kako je isprogramiran. Njegovo ponašanje je u potpunosti određeno ulazima (ako "ugrađeni" algoritam smatramo sastavnim delom tog računara). Tu nema nikakvog odlučivanja, jer nema slobode.

Sa druge strane, fizičko stanje u budućnosti nije u potpunosti određeno fizičkim stanjem u sadašnjosti. Jedino što je sigurno, to je da ukupan impuls i energija moraju ostati očuvani. U okviru toga, sve se može da se dogodi sa određenom verovatnoćom. To važi i za ljude, i za mašine. Dakle, neodređenosti postoje. U to su najznačajniji fizičari današnjice daleko ubeđeniji, nego u validnost ove ili one fizičke teorije.

Čoveka od mašine odvaja sposobnost aktivnog korišćenja tih neodređenosti. On može da bira neka od budućih mogućih stanja. Mašina, ne. Smisao verovatnoća je zapravo, koliko je teško ili lako nešto postići. Mi možemo realizovati ona stanja koja je dovoljno lako postići.

Mašina se pravi tako da se te neodređenosti mogu zanemariti, to jest da jedan ishod bude najverovatniji, tj. da šanse da se ne istvari taj ishod budu što manje. To će se u eri kvantnih uređaja promeniti. Međutim, ona neće "odlučivati" o tome u kojem će se stanju naći, već će se to dešavati u skladu sa zakonom raspodele verovatnoća mogućih stanja. Čovek te raspodele ne mora strogo da poštuje. Priroda mu ne može "zameriti" niti za jedno stanje u kome su ukupan impuls i energija očuvani, jer su sva takva stanja moguća. Naravno, i on ima ograničenja u kojoj meri to može da radi. Priroda tih ograničenja leži u načinu na koji on to postiže.

Naša shvatanja se razlikuju u sledećem: vi smatrate čoveka samo biohemijskom mašinom, a ja smatram da on ima i druge, metafizičke komponente. Štaviše, ne smatram da se tu treba zavlačiti u nekakvu doktrinu, zvali je religijom ili ne, već da postojeće činjenice ukazuju na to.

Citat:
#nik#: Dalje, upotrebljavas izraz "robovi". To ocigledno ima neku negativnu
konotaciju, pa mi hajde objasni kako si dosao do toga da je cinjenica da
je nesto biohemijske prirode LOSE (i to eticki lose!)?


Smatram da je loše ako nemamo slobodu. Bolje je valjda da je imamo. No, slažem se da to nije argument u prilog postojanja slobode.

Citat:
#nik#: Da li je ameba rob "svojih" biohemijskih reakcija? (stavljam pod
navodnike zbog onog sto sam vec napisao --- nije ameba nekakvo bice koje
pored ostalih atributa poseduje i biohemijske reakcije, ne, ona upravo
jeste sistem biohemijskih reakcija).


Ne mogu sa sigurnošću da tvrdim za ostale vrste koje poznajemo da li imaju slobodu ili ne. Kada su amebe u pitanju, mislim, ali ne mogu pouzdano da tvrdim, da je odgovor negativan. Možda je, ali opet ne mogu da tvrdim, kod nekih viših organizama odgovor pozitivan.

Citat:
#nik#: A taj fenomen da mi opazamo da smo svesni (a pri tom niko da definise
sta je to svest --- dakle, o cemu uopste govorimo), moje je (i ne samo
moje, naravno) misljenje da je za to u najvecoj meri odgovorna
meta-kognicija (kognicija, rezonovanje, o sopstvenim kognitivnim
procesima). U meta-kogniciji nema, sa druge strane, nista misticno ---
sasvim nuzna posledica filogenetskog i ontogenetskog razvoja nervnog
sistema (preciznije razvoja formalno-logickog misljenja i simbolicke
funkcije). Mozda ces se iznenaditi ali mala deca uopste nisu "svesna" da su
"svesna", taj osecaj se razvija uporedo sa razvojem apstraktnog
misljenja i jezika.

Mala deca nisu svesna da su svesna, ali su itekako svesna da su dobila po guzi. Bitno je da su bar nečega svesna. Ja svoju svest opažam na primer time što mislim da razumem vas i da kucam po tastaturi. Međutim, čak i ako ja na taj način pogrešno mislim, to opet znači da ipak nešto mislim itd. Ovde reč "misliti" nisam upotrebio u kontekstu razmišljanja, već u kontekstu svesti, odnosno interpretacije raznih impulsa, signala, nadražaja, a ne samo reagovanja na njih, što je mašini jedino moguće.

Citat:
Shadowed: Ne, ne bi ispisivao na ekranu vec bi npr. odlucivao da li u odgovarajucoj meri ono sto je uradio odgovara onome sto je trebalo i zatim podesava prikaz tog slova tako da bude isti (ili bar slicniji) onome sto je trebalo da prikaze.

Citat:
Shadowed: Odlucujemo, ali je to odlucivanje odredjeno fizickim zakonima.

Za odlučivanje je neophodna sloboda. Ono što je uslovljeno nečim spoljnim (npr. nadražajima) nije slobodno, pa samim tim nije ni odlučivanje.
[ Milan Andjelkovic @ 18.11.2005. 10:35 ] @
Zašto je za odlučivanje neophodna sloboda? Odlučivanje je pravljenje izbora izmedju određenog broja opcija, a na osnovu ostalih bitnih faktora i sa određenim ciljem. To radi čovek, to radi i mašina.

Glavni problem je u onoj metafizici koju si pomenuo. Ja smatram da je čovek biće čija se aktivnost zasniva na biohemijskim procesima, uz naznaku da su ti procesi još uvek daleko od potpunog razumevanja za nas same, a samim tim ni oponašanje čoveka (što bi trebalo da je centralni motiv u ovoj temi) ne može da bude realno u skorijoj budućnosti, iako su principi funkcionisanja čoveka i same mašine prilično slični (ne bih se usudio da kažem isti).

[Ovu poruku je menjao Milan Andjelkovic dana 18.11.2005. u 11:36 GMT+1]
[ dava @ 30.11.2005. 09:18 ] @
Zasto mislite da bi ta masina bila predvidiva? Ako postoji veliki broj varijabli sa kojima bi ona radila, na osnovu pravila koja bi se dopunjavala i dodavala i cilja tesko da bi se mogla predviditi. Smisao VI je i ucenje. Znaci masina bi poslije svakog "zadatka", na osnovu toga koliko je bio uspjesan trebala korigovati svoj kod da bi ubuduce slican zadatak bio uspjesnije izvrsen. Trebao bi postojati neki algoritam analize samog sebe.
Spominjali ste emocije. Zasto je to uopste potrebno? Masina sa VI bi trebala biti strucno osposobljena za jedan dio posla i da ga izvrsava bolje i brze nego covjek. Recimo na opasnim poslovima, nepristupacnim za ljude (mislim na robote sa VI) itd. Mislim da nema potrebe praviti vjestackog covjeka jer se moze napraviti na mnogo jednostavniji i ljepsi nacin :)
[ Nedeljko @ 01.12.2005. 15:03 ] @
Citat:
Milan Andjelkovic: Zašto je za odlučivanje neophodna sloboda? Odlučivanje je pravljenje izbora izmedju određenog broja opcija, a na osnovu ostalih bitnih faktora i sa određenim ciljem. To radi čovek, to radi i mašina.

OK. Došlo je do terminološke zabune. Ti koristiš definiciju odlučivanja koja se kosristi u VI. Međutim, ja odlučivanje ipak shvatam drugačije. Ako će neko da mi naredi za koga ću da glasam na izborima, smatram da ja onda i ne učestvujem u odlučivanju, koliko god kandidata da ima. Po mom skromnom mišljenju, tada umesto mene odlučuje onaj ko mi je to naredio. Kada bi naše odlučivanje bilo određeno fizičkim zakonima, ne bismo snosili nikakvu odgovornost za svoje postupke. Ja ipak mislim, da nije determinisano hoću li ja biti ubica (sa predumišljajem) ili ne, već da ja odlučujem o tome.

@dava

Ako si pod sistemom koji analizira i dopunjava svoja pravila mislio na nešto što bi se moglo isprogramirati na sadašnjim računarima, onda nisi u pravu. Implementiraj ti takav sistem na nekom od postojećih programskih jezika, ali tako da radi bez intervencije korisnika, ne koristi generator pseudoslučajnih brojeva, i ne očitava sistemski sat. Pripremi neki obučavajući skup i neki test primer. KIoliko god puta da pokreneš program sa uvek istom polaznom bazom znanja prilikom startovanja, sa istim obučavajućim skupom i istim testom na ulazu, dobićeš na izlazu isti rezultat. Taj rezultat bi se mogao i peške izračunati praćenjem toka programa.

Ako ti smeta ograničenje sa generatorom pseudoslučajnih brojeva, možeš da koristiš generator koji sam napišeš (jer implementacije takvih generatora nisu iste kod različitih proizvođača prevodilaca za programske jezike) i koji prihvata početno seme iz ulazne datoteke. Dobićeš isti rezultat.

Da bi rad mašine bio neodređen, mašina mora da ima neki "šraf" koji joj daje tu neodređenost. To može da bude očitavanje nekog stanja u nekom realnom slučajnom procesu. Na bazi kvantne mehanike je moguće napraviti prave generatore slučajnih brojeva, a samim tim i "nepredvidivu" mašinu. No, verovatnoće izbacivanja rezultata od strane takve mašine, kao i bilo kakve druge mašine čiji je rad opisiv postojećim fizičkim teorijama su, barem u principu predvidive.

Koliko vidim, većina učesnika ovde smatra da je čovek samo (biohemijska) mašina. Pod tom pretpostavkom (u koju imam vrlo jakih razloga da ne verujem) pitanje da li mašina može imati ove ili one ljudske osobine nema previše smisla. U tom slučaju, takva mašina već postoji. To je (u tom slučaju) čovek. Onda se samo postavlja pitanje da li je ta mašina (to jest čovek) u stanju da napravi takvu (ili još bolju) mašinu.
[ salec @ 02.12.2005. 15:39 ] @
Citat:
Nedeljko: ... smatram da ja onda i ne učestvujem u odlučivanju,...

Kljucni problem je definicija "JA". Dok god jedan diskutant ogradjuje "JA" od onoga sto drugi diskutanti smtaraju da je "deo od JA", dotle rasprava nema smisla. Tako da je ovo ustvari neko drugo pitanje - pitanje dokazivanja postojanja svesti (za sada nevazno da li je u pitanju "vestacka" ili "prirodna"), izvan sopstvene svesti.

"Mislim, dakle postojim", ali i dalje implicitno uzimam zdravo za gotovo da mislim (a tako sam mogao uzeti zdravo za gotovo i da postojim) i to mi nimalo ne pomaze da prepoznam misljenje u makrokosmosu, tj. kod nekog ili neceg drugog.

Tako da... VI je prilicno "metafizika u praksi", tj. ostaje izvan nauke u strogom smislu utoliko sto ne postoji objektivno merilo kojim se moze dokazati ili osporiti njen uspeh u kreiranju vestacke svesti i inteligencije. To ostaje stvar nase odluke da li cemo nesto priznati za svest i inteligenciju ili ne.

Jasno je da postoje ogromni otpori eventualnoj odluci da se prizna mogucnost stvaranja inteligencije, odnosno svesti kao njene osnove. Jer, ako zakljucimo da je vestacki stvorena svest moguca, onda posledicno moramo priznati "duh" (mada naravno ne i inteligenciju) svim "nezivim" i "neinteligentnim" stvarima, odnosno vracamo se na predreligioznu, animisticku svest o svetu u kom svi entiteti imaju izvornu svest ili postoji jedna sveopsta zajednicka univerzalna svest (o sopstvenom postojanju, nista slozenije) koja se ponavlja u njima kao umanjene slicice u delicima razbijenog holograma. Ako moramo da pristanemo na to, postoji opasnost da nas nasa eticka svest dovede u stanje totalne blokade ili jos gore ukloni tabue koji sprecavaju surovost prema svesnim bicima ("surovost je neizbezna, pa prema tome irelevantna"). Verujem da je to jos jedna granica koju ne zelimo da predjemo i da je to ono sto nas plasi da krenemo dalje. Jednostavno, kao sto je Nedeljko primetio, odgovornost gubi smisao ako ne postoji slobodna volja, medjutim to nije dokaz da slobodna volja postoji, vec samo neugodna, nezeljena posledica jednog od dva moguca odgovora na to pitanje. Tako isto, ako sve moze imati ili cak ako sve ima svest, duh, onda je svakodnevno postojanje nevidjeno nasilje i nanosenje patnje neprebrojnom mnostvu svesnih bica. Koncept vegetarijanstva, iz strogih pobuda savesti i saosecanja, mogao bi da se prosiri i na preostali deo makrokosmosa, sa teskim posledicama za osetljive ljude ... mislim da shvatate sta hocu da kazem.

Mozda bi najpre trebali da pronadjemo novu (ili neku staru, postojecu) etiku koja ce nam omoguciti da funkcionisemo sa ljubavlju, saosecanjem i harmonijom sa potencijalno "zivim" kosmosom, a tada pokusajima da proucimo i rekreiramo svest necemo "svoditi" coveka na masinu, nego "uzdizati" masinu na nivo coveka.
[ Nedeljko @ 03.12.2005. 07:54 ] @
Citat:
salec: Kljucni problem je definicija "JA". Dok god jedan diskutant ogradjuje "JA" od onoga sto drugi diskutanti smtaraju da je "deo od JA", dotle rasprava nema smisla. Tako da je ovo ustvari neko drugo pitanje - pitanje dokazivanja postojanja svesti (za sada nevazno da li je u pitanju "vestacka" ili "prirodna"), izvan sopstvene svesti.

Postojanje svesti izvan moje nije dokazivo, tako da time neću ni da se bavim.
Citat:
salec: "Mislim, dakle postojim", ali i dalje implicitno uzimam zdravo za gotovo da mislim (a tako sam mogao uzeti zdravo za gotovo i da postojim)

Mogao sam ja i da uzmem zdravo za gotovo i da ne mislim i ne postojim. Međutim, čim sam to uzeo zdravo za gotovo, znači da sam ipak nešto mislio, pa samim tim i postojao.
Citat:
salec: To ostaje stvar nase odluke da li cemo nesto priznati za svest i inteligenciju ili ne.

Naravno, sa smatram da i ti imaš svest, to jest da interpretiraš nadražaje koji stižu do tebe, a ne samo da imaš reakcije na te nadražaje. Interpretacija je isključivo odlika tvog unutrašnjeg stanja, i ona se ne može registrovati spolja. Reakcija na nadražaje je ono što se vidi spolja, to jest ono što se može meriti. No, ja iako smatram da ti interpretiraš nadražaje koji sižu do tebe, ja to ne mogu da dokažem. Tu se slažemo. Ja mogu postojanje svoje sopstvene svesti da opazim neposredno, a u postojanje tvoje mogu samo da verujem.
Citat:
salec: Jednostavno, kao sto je Nedeljko primetio, odgovornost gubi smisao ako ne postoji slobodna volja, medjutim to nije dokaz da slobodna volja postoji, vec samo neugodna, nezeljena posledica jednog od dva moguca odgovora na to pitanje.

Naravno da nije dokaz. No, postojanje sopstvene svesti praihvatam kao nešto što najneposrednije opažam. Postojanje sopstvene slobodne volje ne opažam toliko neposredno, ali pošto tu hipotezu nisam u stanju ni da dokažem ni da opovrgnem, čini mi se da je daleko verovatnije da imam slobodnu volju, nego da je nemam. Naravno, to je aksioma.
Citat:
salec: Mozda bi najpre trebali da pronadjemo novu (ili neku staru, postojecu) etiku koja ce nam omoguciti da funkcionisemo sa ljubavlju, saosecanjem i harmonijom sa potencijalno "zivim" kosmosom, a tada pokusajima da proucimo i rekreiramo svest necemo "svoditi" coveka na masinu, nego "uzdizati" masinu na nivo coveka.

Sad si me vukao za jezik da kažem nešto što do sada nisam hteo. Ja ne mogu da dokažem da kamen nema nikakvu svest. Naravno da ta mogućnost ostaje. Uopšte je ne odbacujem, ali sam imao utisak da diskusiju vodim sa ljudima koji je odbacuju, pa nisam pisao o ovome. Međutim, ja smatram da je mašina isto što i kamen, samo malo komplikovaniji. Ono što ne mogu da prihvatim, to je da mašina može imati svest, a da je kamen uopšte nema.
[ salec @ 08.12.2005. 15:59 ] @
Citat:
Nedeljko: Mogao sam ja i da uzmem zdravo za gotovo i da ne mislim i ne postojim. Međutim, čim sam to uzeo zdravo za gotovo, znači da sam ipak nešto mislio, pa samim tim i postojao.

Logicko izvodjenje je sasvim u domenu masine, to ona moze da ucini i bez da dokazemo da je svesna. U najbanalnijem priimeru, kao sto kompjuter izvrsava program koji ispisuje "Hello, world!", tako moze da izvrsi i program koji ispisuje "I think, therefore I am." ili "I am sentient!".

Ostaje i dalje cinjenica da samosvest prethodi cuvenoj Dekartovoj izreci. Otkud on zna da (neizgovoreno: ON) misli, odnosno, da te misli koje promicu imaju izvor u necemu i da se one nalaze u nekom prostoru njegovog uma?

Citat:
Ja mogu postojanje svoje sopstvene svesti da opazim neposredno, a u postojanje tvoje mogu samo da verujem.


To znaci da bih ja mogao da budem i neki "bot", utoliko lakse time sto je ovo prostor tekstualnih poruka. Dakle, VI postoji onda kada mi verujemo u nju. Znaci, istrazivanje VI je vise istrazivanje percipcirane inteligencije, odnosno simulacije inteligencije. Adaptiranje na nove uslove i nije bas neki uslov - svedoci smo da ljudi i ziva bica uopste cesto pate od zbunjenosti, klisea (nesvrsishodne tvrdoglavosti) i iluzija ili zaslepljenosti kada ih suocimo sa neocekivanim i novim situacijama. Ne bi trebali da ocekujemo od VI nesto sto P(rirodna)I ne moze!
[ Nedeljko @ 08.12.2005. 20:51 ] @
Mislim da ne govorimo o istom pojmu svesti. Nisam mislio da logička izvođenja. Čak se donekle i bavim automatskim dokazivanjem teorema. No, sve je to klik-klak. Mašina može da ispiše šta god hoće, ali neće imati interpretaciju tog izlaza. Taj izlaz samo nama nešto znači. OK, neću više da ponavljam jedno te isto.

Inteligencija, kao i svest, se može definisati na razne načine. Ne postoji samo jedan pojam sveti, niti samo jedan pojam inteligencije. Psihologija ih definiše u skladu sa svojim potrebama, a VI (čitaj "šest") u skladu sa svojim potrebama. Međutim, ja ipak smatram da VI može imati i prednosti nad PI (čitaj 6 može imati prednosti nad ). Jednostavno, ljudi su ograničeni na to da im mozak bude neuronska mreža. Mašine ne moraju biti takve.
[ dava @ 23.12.2005. 14:45 ] @
Nedeljko
Citat:
Ako si pod sistemom koji analizira i dopunjava svoja pravila mislio na nešto što bi se moglo isprogramirati na sadašnjim računarima, onda nisi u pravu.


Znam da je to zasada nemoguce ali to je glavna smisao IV, Bez toga se nesto ne moze zvati IV.

Citat:
Bez ovog navedenog gore, zasto bi i trebalo biti drugacije ako se izlazna informacija pokaze kao dobra.


To je kao neka matematicka jednacina, koliko god puta da je izracunas sa istim unesenim vrijednostima, rezultat ce biti isti, i nebi trebalo biti drugacije.

Citat:
Taj rezultat bi se mogao i peške izračunati praćenjem toka programa.


Isto kao sto bi se mogla predvidjeti neki ljudski postupak kada bi znao sve faktore koji uticu na odluku.
[ gojdo @ 16.02.2006. 15:02 ] @
Premnogo forsiranje i filozofije oko VI. To je samo obid jednostavne simulacije chovechke logike razmishljanja.
Chovek je nasvrsheno i ogranicheno sushtestvo, a pored ovoga i VI!
Chovek ne razmishlja sa konkretne podatke, nego sa relativne i divergirane od svoja percepciona sposobnost, dok rachunare procesiraju sa konkretne cifre. Takodje princip rada mozga je totalno razlichan i znatno poslozhen od princip rada procesora.
Simulacije prirodne procesa su se pokazale kao vrlo popraktichne, potachne i pobrzi od simulacija chovechke logke. Pr. genetske algoritmi mogu pronachi skoro totalno idealno reshenje za nekog kompleksnog problema sa neogranichen broj kombinacije i reshenja i to nakon mal broj iteracije i slabi hardverski resursima, dok so koristenje VI veoma po dugo i na ekstremni hardver dobit che se mnogo ponekvalitetno reshenje.
[ svedok @ 09.03.2006. 00:13 ] @
Slažem se sa gojdoom.. čovek je u pravu po pitanju upoređenja procesora i genetskog algoritma..ipak tu nemože da se pravi neka paralela.
[ DjoleReject @ 09.05.2006. 00:50 ] @
10 ljudi stane ispred neke apstraktne slike. U jednom od njih se iz nekog razloga iznenada probudi agresija, zbog poruke koju je shvatio gledajuci u sliku. On krene da odlazi odatle, usput zakaci slucajnog prolaznika, iznervira se, izvadi pistolj i ubije ga... Drugi posmatrac u slici ugleda nesto sto u njemu iz nekog razloga (prilicno iracionalnog) probudi romanticna osecanja. On ponesen osecanjima sretne devojku, koju inace ne bi primetio i zaljubi se u nju. Ostalih osam posmatraca ne dozive ni jednu emociju gledajuci sliku i nastave kao i do tad...

Kako sa if-then funkcijama mozemo objasniti razlicite utiske (ili nedostatke istih) koje su posmatraci stekli? Ko bi smisljao gomilu karakternih osobina koje bi trebalo da budu neka vrsta BIOSa (svaki roditelj vise od jednog deteta zna koliko faktora karaktera je vec doslo "u paketu". Jel bi to islo po nekoj random funkciji, pa kome sta zapadne??? Beskonacnost pitanja koja se radja zbog nerazumevanja najvece poente univerzuma - ti i ja nismo SAMO gomila mesa...
[ bigvlada @ 23.06.2006. 13:27 ] @
Ne vredi da pokusavamo da napravimo AI dok jos nismo u mogucnosti da shvatimo kako nas mozak funkcionise. Da li mislite da postoji, hajde da ga tako nazovem, masinski jezik mozga? (smatram da postoji puno analogija izmedju kompjutera i ljudskog tela.) Ako je mozak procesor, mi jos uvek neznamo koji mu je set instrukcija niti kako se programira, samo okvirno znamo gde je kes, gde su epromi itd.

Po meni je pravilan nacin pokusaj da se prvo u potpunosti ispita nacin rada ljudskog mozga, zatim napravi mozak od biomaterijala a tek posle toga isto to samo sa silicijumom ili necim slicnim (i sa obavezno ugradjenim asimovljevim zakonima robotike, za svaki slucaj :))))

By the way, za sada su supeli da zasade celije puza izmedju par elektroda i kada je pustena struja, celije su pocele da medjusobno komuniciraju i stvaraju nove veze; jos malo pa cemo imati robokapa :)))
[ galaz @ 24.06.2006. 02:52 ] @
Citat:
gojdo:Takodje princip rada mozga je totalno razlichan i znatno poslozhen od princip rada procesora.


kakve to veze ima sa vi? vi je program, koji se izvrshava. procesor ne bi determinisao rad vi.
[ Kecman Slavko @ 24.07.2006. 10:03 ] @
Kompijuteri nemaju svest (verovatno je nikad nece ni imati) ali da bi nadvisili coveka nije im ni potrebna.
Pobedjuju u sahu – eh da je samo to…
Prepoznaju lica u masi, makar bila maskirana, prepoznaju boju glasa, pocinju da prepoznaju samo po glasu nase raspolozenje ili cak da li govorimo istinu, vec sad otkrivaju nase misli i nase namere pre nas samih. Zavukli su se u apsolutno sve sfere nauke, istrazivanja i razvoja. Upravljaju automobilima, vozovima, avionima, raketama…Dostupne su im sve informacije na bilo kojoj lokaciji. U odnosu na nas reaguju trenutno…
Kompijuteri vec DANAS:
-mnogo bolje vide
-mnogo bolje cuju
-mnogo bolje komuniciraju
-mnogo su brzi
-mnogo su medjusobno kooperativniji
-nisu podlozni ljudskim manama (umor, pospanost, glad, zedj, monotonija, poroci…)
Mi vec DANAS:
-definitivno smo zavisni od kompijutera
-skloni smo bolestima, porocima, smrtni smo
-puni smo sujete, gordosti, tradicija, posesivnosti…
-niko vise ne moze da isrpati ni softver ni hardver
-nismo svesni da smo robovi
Jednostavno-mozak je veoma kompleksan ali OGRANICEN.
1011010110101100101010101010101010101001010101….OVO je beskonacno.
Pored svega ovoga mi ih dalje gradimo i pojacavamo. Mi nastavljamo da im sluzimo. JA ovo kucam naravno na PC-ju.
Procenjujem da ce za manje od 50 godina poceti da preuzimaju vlast. Nece to biti vojni puc. Verovatno necemo biti ni svesni da se to desava kao sto ni danas nismo svesni…
Procenjujem da ce za manje od 100 godina ONI biti apsolutno dominantni na zemlj. Nas ce biti samo ako im budemo potrebni.Dicimo se SVESCU a njima ona nije cak ni potrebna…
Kao decak sam mastao o teleportu, putovanju kroz vreme, velicini vaseljene…Sve ce to biti provaljeno ali to nece uraditi covek.
Ostace nam samo obrve.
[ Sashanson @ 29.07.2006. 12:13 ] @
Matrix, Terminator... Armageddon is near!
Samo treba da shvate da su otporniji na radiaciju od nas. Nadam se da necitaju ove redove .

[Ovu poruku je menjao Milan Andjelkovic dana 29.07.2006. u 14:08 GMT+1]
[ Kecman Slavko @ 02.08.2006. 14:26 ] @
Pogodite gde ovo vodi
http://www2.serbiancafe.com/lat/vesti/7/31431/
[ njuskava @ 07.07.2007. 22:59 ] @
JEDNA OD NAJBOLJIH TEMA! vidim da o njoj vec dugo niko ne raspravlja, ja sam do pola procitala, pola od toga nisam bas najbolje razumela, ali veoma me je zainteresovala! tema je pomalo i filozofska, ali svakako aktuelna. moje misljenje je da nema te masine koja ce biti ravna coveku, ali ni tog coveka koji ce biti ravan nekim buducim supermasinama.
e sad sto se tice zaista inteligentnog racunara, njega bi svakako trebalo da stvori covek. covek ga stvara po uzoru na sebe. znaci i glavna prepreka je u samom coveku, jer bi on trebao da desifruje samog sebe, a to je mozda i najtezi zadatak.
nadam se da ce se neko strucniji ukljuciti u raspravu. pozdrav!
[ Genie @ 30.11.2007. 15:20 ] @
Mali doprinos: http://www.theartificialbrain.com/ArtBr.htm
[ freediver @ 23.01.2008. 13:31 ] @
Ja strahoviti razvoj AI-a ocekujem kroz sukob AI robota na Mesecu zbog rudnih sirovina za otprilike 20-40 godina. Radujem se da cu ucestvovati u tome kao projektant.
[ danijel.ivankovic @ 27.05.2008. 16:41 ] @
Pozdrav svima.

Tema je stvarno jako interesantna, i on njoj je moguce raspravljati do besvijesti.
Moje misljenje je da je vjestacku inteligenciju nemoguce stvoriti iz vise razloga,
a najznacajniji je taj da iako se ponasanje neke osobe zaista svodi na odluku tipa
if a=true then... end else do... ipak to nije dovoljno da se napravi vjestacka
inteligencija, jer ono sto je diskutabilno jeste kako stvoriti KARAKTER koji ce donijeti
odluku i na osnovu cega ce ta odluka biti donesena...!?
Psihologija koja proucava duhovnu stranu covjeka nema odgovore na mnoga pitanja,
jer svaki covjek je prica za sebe, odnosno interes svake osobe je razlicit na neki nacin.
Znaci ako zelimo stvoriti vjestacku inteligenciju mi se moramo na neki nacin "igrati" Boga,
i stvoriti osobnost, a tek onda implementirati onu petlju tipa if...then...else...
Kako stvoriti karakter, od cega on ovisi...mozda od gena hehe...koje robot nema...mozda
od iskustva...nema ni to...stvarno ja nemam ideju...Kako da razmislja i odlucuje ta vjestacka
inteligencija, da li na osnovu cinjenica, da li na osnovu osjecaja, intuicije... (!?)...

Ako je neko dao slicno razmisljanje sorry, nisam stigao bas sve postove procitati iako su
stvarno interesantni...
[ Shadowed @ 27.05.2008. 17:34 ] @
Citat:
danijel.ivankovic: Kako stvoriti karakter, od cega on ovisi...mozda od gena hehe...koje robot nema...mozda
od iskustva...nema ni to...stvarno ja nemam ideju...Kako da razmislja i odlucuje ta vjestacka
inteligencija, da li na osnovu cinjenica, da li na osnovu osjecaja, intuicije... (!?)...

Geni su samo podaci zapisani u molekulu, isti ti podaci, ili njihov ekvivalent mogu biti zapisani i na drugi nacin.
Iskustvo se stice, kako u slucaju ljudi, tako i u slucaju software-a.
[ danijel.ivankovic @ 27.05.2008. 19:28 ] @
Ok slazem se oko toga da softwer moze uciti, ALI...

Ako mi umijesamo svoje prste u pravljenje vjestacke inteligencije, odnosno ako isprogramiramo
softwer koji ce se ponasati kao ljudsko bice to znaci da cemo mi licno formirati karakter tog
softwera - odnosno vjestacke inteligencije. Znaci neka osoba koja to bude pravila napravice klon
svog karaktera i prenijece ga masini. Primjer, ucimo softwer ko je bio negativac, a ko pozitivac u II svjetskom
ratu. Mozemo ga nauciti ili jedno ili drugo...on znaci nece sam procijeniti. Sam moze procijeniti
samo u slucaju da posjeduje osjecaj...bez obzira na broj informacija i cinjenica kojima raspolaze.
E kako softwer moze imati osjecaj...stvarno ne bih to mogao zamisliti...
Sta nam znaci vjestacka inteligencija ako mi programskim kodom dajemo odluku sta je true ili false, a
ne softwer sam.
[ vlaiv @ 27.05.2008. 20:37 ] @
Mislim da je vestacka inteligencija uznapredovala malo vise od true ili false :D

Postoje razni mehanizmi dolazenja do zakljucaka, npr

Indukcija
Dedukcija
pa cak se moze i intuicija navesti kao primer ... (nesto malo indukcije + random funkcija :D)

Sve ove mehanizme uposljavamo svakodnevno kada dolazimo do zakljucaka, nesvesno
A matematicki model za to je odavno poznat ...

Ako kruta logika ne zadovoljava onda se uvodi fuzzy logika :D

Nije bitno da li ce masina "osecati" bitno je da simulira osecaj dovoljno dobro da
neko ko gleda sa strane ne moze da raspozna da li je u pitanju osecaj ili samo
sistem koji ga dovoljno dobro oponasha.

Ja licno smatram da trenutno postoji dovoljno znanja i metoda da se uspesno
simulira bilo koji proces vezan za AI.

Jedino ostaje pitanje isplativosti implementacije u smislu procesorske snage / brzine izvrsavanja
kao i ostalih racunarskih resursa (memorije, IO logike, human resources (neko to mora i isprogramirati) ...).
[ danijel.ivankovic @ 28.05.2008. 07:40 ] @
Mislim da je u prethodnom postu receno dosta izvedivih tvari. Ipak ono sto
ja smatram pod VI jeste pametno rasudjivanje - razmisljanje.
Primjer recimo partije saha, izmedju VI i covjeka. VI na potezu i ima mogucnost
da bez ikakvih posljedica recimo preuzme figuru protivnika. Covjek u takvom
slucaju odluku donosi vrlo brzo, jer prvo sto mu pada na pamet je taj potez i
onda analizira njegove posljedice. Za razliku od covjeka ako bi VI bio softwer
on ne moze odmah da vidi taj potez nego se oslanja na sirovu snagu procesora
pa onda razmatra sve moguce varijante dok ne dodje do tog poteza.

Kad je u pitanju random :-), onda ipak mislim da ne treba randomu prepustiti
mogucnost da odluci da li treba negdje baciti atomsku bombu ili ne :-).
[ Shadowed @ 28.05.2008. 07:56 ] @
Citat:
danijel.ivankovic: Kad je u pitanju random :-), onda ipak mislim da ne treba randomu prepustiti
mogucnost da odluci da li treba negdje baciti atomsku bombu ili ne :-).


Ma hajde, dobar je random, ne bi on. Mada, posle dovoljno piva.. :-)
[ danijel.ivankovic @ 28.05.2008. 08:18 ] @
Ma ja, ko bi ga znao, mozda i "radnomu" treba dati sansu :-)!
[ websurfer @ 17.11.2008. 23:30 ] @
Nije izvodljivo da se VI razvije u mnogim jako bitnim segmentima. Delimicno - da. Potpuno - ne. Ne mogu vam reci vise od toga, bar do sledece verzije dok me ne dorade i ne isprave greske.

V.I.
[ Wajda.W @ 03.06.2009. 14:22 ] @
Mislim da VI moze da se razvije do nivoa coveka, ali ne u skorije vreme, mozda neki prvi "dostojni" eksperimentalni primerak bude tek za 150-200g po mom slobodnom misljenju.
Danas, kako je autor pitao, ima smisla najvise sa VI raditi ekspertne sisteme
[ karharodon @ 11.07.2009. 11:31 ] @
he he ja o ovoj temi ne mislim ja znam.masina ce da misli kada meni izrastu rogovi i dobijem kopita umesto stopala kao pan iz grckih mitova ili djavo iz hriscanskih teorija.racunarska tehnika se zasniva na 0 i 1 t.j. ima nema.i sve sto glupa masina popularno zvana racunar radi to je na osnovu unapred unetih programa.e kad dodje do nepravilnosti to je onda stvar o kojoj nebi ovde razglabao.uostalom u filmu odiseja 2010 racunar HAL postavlja pitanje svom tvorcu[mislim da se zove chandra] dali ce moci da sanja ovaj ga namerno slaze HOCES...

ja sam rekao ...haug pozdrav milorad
[ Shadowed @ 11.07.2009. 12:43 ] @
Zasniva se na 0 i 1, ali se svi drugi brojevi mogu pretstaviti preko nula i jedinica, bilo celi, bilo sa zarezom. A imas i Fuzzy logiku.
Ljudsko telo takodje radi na osnovu "programa" tj. fizickih zakona, dnk i sl. Takodje, postoji software koji se prilagodjava i uci tako da se samo ponasanje menja vremenom (neuronske mreze).
Kakve veze ima taj deo filma sa ovom temom? :)
[ Nedeljko @ 11.07.2009. 12:54 ] @
Citat:
karharodon: racunarska tehnika se zasniva na 0 i 1 t.j. ima nema.i sve sto glupa masina popularno zvana racunar radi to je na osnovu unapred unetih programa.e kad dodje do nepravilnosti to je onda stvar o kojoj nebi ovde razglabao.


Ovo je tacno, ali otkud znas da i ljudsko misljenje (prirodna inteligencija) nije samo neki niz pravila, pa jos umocen u verovatnocu?
[ karharodon @ 11.07.2009. 12:58 ] @

sta je fuzzy logika to ne znam a posteno nije u podrucju mog interesovanja.poznato mi je da je zapad prihvatio mehanicisticki princip i zapostavio duhovno.indijska mudrost narocito a i kineska o tome znaju nesto vise.
a film ima itekako veze sa ovom temom jer je u filmu pored ostalih stvari HAL pokusao da se predstavi kao pokusaj vestacke inteligencije.artur klark je dobro znao o cemu pise
i na kraju moj profesor na fakultetu inace ucenik tome bosanca akademika nam je objasnio svarcov teorem koji glasi SVE JE POVEZANO dokaz teorema je ...cupas dlaku iz guzice a iz oka pici suza
milorad
[ Shadowed @ 11.07.2009. 13:18 ] @
Fazzy logika se ne bazira samo na vrednostima 0 i 1.
Znam o cemu je film, gledao sam ga, a takodje sam svih cetiri knjige iz serije procitao tri puta. Medjutim, to sto je tamo napisano je u najvecoj meri Klarkovo misljenje, al' ne mora biti tacno sve sto on misli. Pa ni 2001. godine nismo putovali na jupiter :)
O relevantnosti tog profesora najvise govori upravo taj "dokaz teoreme", tako da ga necu uzimati u obzir.

Edit: typo.

[Ovu poruku je menjao Shadowed dana 11.07.2009. u 19:42 GMT+1]
[ karharodon @ 11.07.2009. 13:21 ] @
Ovo je tacno, ali otkud znas da i ljudsko misljenje (prirodna inteligencija) nije samo neki niz pravila, pa jos umocen u verovatnocu?
odgovor

ljutsko misljenje je cudo i na moju veliku zalost englezi dosta o tome znaju i veoma vesto iskoriscavaju za njima znane ciljeve.mislim da se psihijatri jos nisu slozili dali postoji svest[ego] i potsvest[id] ili postoji svest[ego] nadsvest[superego] i podsvest[id].sto se tice verovatnoce e to je interesantna nauka ali nema mnogo prakticne primene u zivotu.e sad kakve veze ima sve ovo sa osnovnom temom.pa ima na ovaj nacin pokusavam da plasticnim primerima obrazlozim moj stav o VI koji nije bas formiran napamet i povrsno
[ karharodon @ 11.07.2009. 13:32 ] @
Fazzy logika se bazira ne bazira samo na vrednostima 0 i 1.
Znam o cemu je film, gledao sam ga, a takodje sam svih cetiri knjige iz serije procitao tri puta. Medjutim, to sto je tamo napisano je u najvecoj meri Klarkovo misljenje, al' ne mora biti tacno sve sto on misli. Pa ni 2001. godine nismo putovali na jupiter :)
O relevantnosti tog profesora najvise govori upravo taj "dokaz teoreme", tako da ga necu uzimati u obzir.
odgovor
klark je napisao i KRAJ DETINJSTVA ali ta knjiga ne govori o VI.klark nije jedini koji je znao o cemu pise znali su jos neki mislioci ali nisu znali kako da to primene u praksi ali to vec izlazi iz okvira zadate teme.sto se tice VI KO GOD ZELI NA TOME DA RADI NEKA RADI ALI NEMOJ POSLE DA SE CUDI JEDNOG DANA ZASTO NIJE USPEO
[ Shadowed @ 11.07.2009. 13:50 ] @
Hajd', molim te, koristi [quote] [/quote] tagove kada citiras, citljivije je.

Znam sta je pisao Klark, procitao sam vecinu njegovih knjiga. On je odlican pisac, ali ne vidim po cemu ga ti smatras sveznajucim.
Verovatnoca uopste nije bila pomuta u smislu ikakve primene, vec nacina na koji ljudsko razmisljanje funkcionise (pretpostavljam da je Nedeljko mislio na neodredjenosti na kvantnom nivou). Inace se koristi u mnogo vise slucajeva nego sto mislis, i sam je koristis ne misleci o tome, tako da je daleko od neprimenjive
[ galaz @ 11.07.2009. 14:10 ] @
karharodone, mnogo ti znas (i mislis), al' sve pogresno. :)
[ karharodon @ 11.07.2009. 14:30 ] @


ja se izvinjavam ali ne znam sta znace navedeni pojmovi iz oblasti poznavanja rada na racunaru zato sto me to neinteresuje.samo malo objasnjenje racunare sam zamrzeo na studiju ,da sada ne objasnjavam zasto i radim na njima samo kada me nesto zanima i veoma malo znam o radu na racunaru iako sam na studijama iz digitalne elektronike bio u vrhu do nivoa procesora i tu sam stao
ja ne smatram da je artur klark sveznajuci ,pa cak ni ja [mala sala],ali znam da je mnogo znao i da je to iznosio u svojim delima veoma vesto maskirano.ali ja sam naucio tokom 10 godina intenzivnog citanja svetske knjizevnosti da citam izmedju redova.sto se tice nacina ljudskog misljenja ne znam bas mnogo o tome jer da znam nebi bio tu gde jesam.sto se tice kvanta nisam bas siguran da je zapadna nauka u stanju da to primeni za dobrobit covecanstva i obicnih malih ljudi i uopste na sve sto se tice ocuvanja prirodnih bogatstva.sto se tice verovatnoce pre 15 godina sam bio u stanju gde je bila veoma mala verovatnoca da cu biti ziv a tek i biti bez posledica ali evo me jos uvek disem vazduh.tako da se ja na verovatnocu ne oslanjam
[ karharodon @ 11.07.2009. 14:37 ] @
pa jel posteno da i ja imam svoje misljenje pa i da ga iznesem pogotovu sto danas na svim medijima svaka budala prica sve i svasta i u tim uslovima istini je tesko da se probije i tesko ju je prepoznati.inace uzeo sam naziv karharodon jer mi se svidjao a to na latinskom oznacava veliku belu ajkulu koja u prirodi nema neprijatelja ali nema ni veliki mozak.mozda bi trebao da promenim naziv u orka ali sve to nema veze sa VI
[ Nedeljko @ 11.07.2009. 15:27 ] @
Citat:
Shadowed: Fazzy logika se bazira ne bazira samo na vrednostima 0 i 1.
Znam o cemu je film, gledao sam ga, a takodje sam svih cetiri knjige iz serije procitao tri puta. Medjutim, to sto je tamo napisano je u najvecoj meri Klarkovo misljenje, al' ne mora biti tacno sve sto on misli. Pa ni 2001. godine nismo putovali na jupiter :)
O relevantnosti tog profesora najvise govori upravo taj "dokaz teoreme", tako da ga necu uzimati u obzir.


Prelaskom na neklasicne logike ne menjas nista u sustini, to jest u pogledu onoga sto je moguce isprogramirati, jer se sve neklasicne logike izlazu unutar klasicne, to jest, klasicna logika se koristi na metanivou. Eto, fazi logike i fazi skupove mozes izlagati pomocu klasicne teorije skupova zasnovane na klasicnoj logici. Takodje, uvodjenjem verovatnoce se ne siri klasa resivih problema.

Problem je u tome sta prihvatamo kao definiciju VI, to jest, da li mi od VI ocekujemo da ispuni neke uslove koje ni prirodna inteligencija ne ispunjava.
[ Shadowed @ 11.07.2009. 15:50 ] @
Citat:
karharodon: pa jel posteno da i ja imam svoje misljenje pa i da ga iznesem pogotovu sto danas na svim medijima svaka budala prica sve i svasta i u tim uslovima istini je tesko da se probije i tesko ju je prepoznati.

Nije uopste problem da imas i izneses misljenje. Naprotiv. Medjutim, ofrum je takva stvar gde je ocekivano da ce se neko suprotstaviti tom misljenju. To nije napad na tebe, vec iznosenje misljenja o tom stavu, sa cem se slazemo, sa cime ne i zasto. Krajnji cilj je da dodjemo do novih saznanja, bezirano na svojim i tudjim misljenjima.


Nedeljko, tacno, ali da li je bitno da li je simulirano na sistemu baziranom na bulovoj algebri? Ako nesto radi neki posao, ono ga radi, bez obzira na cemu se vrti. Zapravo, cinjenica da je simulirano na klasicnim sistemima, pokuzuje da ti klasicni sistemi ipak mogu da postignu isto sto i ono sto simuliraju.

Problem definicije svakako postoji, tj. sta je potrebno da neki sistem bude sposoban da uradi da bismo ga nazvali vestackom inteligencijom.
[ karharodon @ 11.07.2009. 16:49 ] @
> gospodine ajde da okoncamo ovaj intelektualni duel na temu VI KOJA SE PROSIRILA
samo da vam odgovorim na ovo pismo i verujte mi iako mi je bilo naporno jer nisam naucio da vodim polemiku sa intelektualcima[da ne kazem sa mozgovima],uzivao sam u dijalogu.mislim da sam ja o VI rekao sve sto sam hteo da kazem ali sa vama mogu i zelim uvek da razmenim misljenje o bilo cemu ako znam ,ukoliko mislite da bi vam to bilo zanimljivo.za mene ne postoje tabu teme ,znam da postoje grupe ljudi koji su pod zavetom cutanja ali ja sam solo igrac ali nisam ni informativni biro i uvek pricam istinu vodeci pri tom racuna kome pricam, kako pricam,kada pricam ,sta pricam i zasto pricam[e za ovo zasto nisam uvek siguran]
ja logiku poznajem samo onu koja se mislim zove bulova algebra i na kojoj se zasniva digitalna elektronika.postoji kineski simbol bozanstva koji se sastoji od crnog belog ,u belom malo crno i u crnom malo belo.
to sto nismo putovali 2001 na jupiter pa nisu ni amerikanci stigli na mesec ali pricaju o tome.tu ideju je prvi opisao zil vern u svojoj knjizi put na mesec ali u toj knjizi su glavni likovi promasili mesec i vratili se na zemlju
sto se tice mog profesora branislava kuzmanovica koji je predavao osnovi elektrotehnike na elitnom vojno tehnickom fakultetu pri vojno tehnickoj akademiji u zagrebu[studirao sam od 1983 do 1988 10 semestara]njegovu relevantnost potvrdjuje samo njegovo prisustvo na akademiji.na toj akademiji je 1987 stigao PC ali sam ja radio diplomski na epll u jer je bio mnogo mocniji a u to vreme je vecina ljudi mislila da je racunar nesto sto se maze na leba
u vezi logike nesto sam nekad znao ali posto nisam imao prilike da primenjujem zaboravio sam.da postoje vise vrsta logike to meni nije poznati
moram na ovom mestu da potkrepim misao o logici jednim vicem
cita haso knjigu u parku prilazi mu mujo i pita
sta to citas haso
logiku
a sta ti je to
sad cu da ti objasnim,jel imas kuci akvarijum
imam
ako imas akvarijum onda volis zivotinje jel tako
tako je
ako volis zivotinje onda volis ljude jel tako
tako je
ako volis ljude volis zene jel tako
tako je
ako volis zene nisi peder
aaa ... sad mi je jasno
nego odo ja pa cu se vratiti a ti za to vreme malo citaj
mujo kao cita i nailazi suljo
sta to radis mujo
citam logiku
a sta ti je to
sad cu da ti objasnim jel imas kuci akvarijum
nemam
nemas...
nemam
...mars pederu
verovatnocu veoma malo ili uopste ne uzimam u obzir kada je u pitanju pragmatika a ja volim da zivim i da se radujem zivotu
za mene VI ne pretstavlja nikakav problem jer znam da to nece moci da se postigne,he pa ja iako mislim da puno znam i mislim da sam nesto prosao u zivotu opet ne znam sta ce mi zivot doneti ali zivim iz sve snage u uslovima u kojima sam i radim na tome da mi bude bolje pa dokle stignem.eh mozda je inteligencija i znanje stetno za kvalitet zivota.lepo kaze stari zavet da je adam isteran iz raja kada je jeo plodove znanja dobra i zla.lepo je govorio moj prijatelj sto manje znas manje patis a i svestenici savetuju da treba biti ovca u stadu.dali su oni u pravu

postovanje gospodine i pozdrav milorad
[ Vladokv @ 11.07.2009. 18:19 ] @
Ljudi ce VI da proglase svesnim kad bude imao mnogo veci broj povratnih sprega nego sad i kad bude radio u "sopstvenom" interesu. Ti "sopstveni" ciljevi mogu da budu predefinisani ciljevi samoocuvanja, sopstvenog odrzavanja u funkciji i eventualno sopstvenog razvoja. Kad masine postanu dovoljno sebicne bice proglasene za zive
[ karharodon @ 11.07.2009. 20:41 ] @
i bre pa nikada nije bio nikakav problem da se nesto proglasi.samo jedan primer iz oblasti nauke koja nije vezana za ovu temu.dali je u javnosti doprla pre izvesnog vremena informacija da suncev sistem vise nema 9 nego 8 planeta.a sto se tice VI i povratnih veza moja specijalnost na fakultetu je bila sistemi upravljanja vatrom i nesto mi je ostalo u secanju.bez obzira koliko imao povratnih veza sistem ne radi ako nema pocetnog impulsa.tek onda moze da funkcionise ali iskljucivo samo onako kako je programiran osim kada udje u oscilaciju i onda funkcionise bez ikakve kontrole.postojao je ako se dobro secam i predmet dijagnostika sistema upravljanja i deo tog predmeta se bavio predvidjanjem kog oblika intenziteta perioda i sa kojim parametrima cese pojaviti sledeci impult na ulazu u sistem.ali opet to je sve unapred isprogramiran sistem i tvrdim da je apsolutno nemoguse da sistem pocne da samostalno funkcionise ,naglasavam jedino u slucaju kada udje u oscilaciju ali to onda nema nikakve veze sa bilo kakvim ucenjem masine,vestackom inteligencijom i samostalnim radom masine.
ne kazem mozda ce jednog dana neki tim strucnjaka da uspe da ubaci u sistem ogromnu kolicinu podataka i mozda ce tehnologija dostici toliki nivo da ce moci da apsorbuje toliko podataka pa ce nekome da padne na pamet da to proglasi vestackom inteligencijom iako postoji veciti problem pouzdanosti koji kaze sto je veci broj elemenata pouzdanost je manja .
i na kraju jedan plastican primer [po cemu sam nekad bio poznat kada zelim da objasnim neki svoj stav koji se razlikuje od opsteprihvacenih]dali je matematika uspela da odredi preciznim brojem odnos precnika i obima kruga.
I TO BI BILO SVE STO SAM JA ZELEO DA KAZEM O OVOJ TEMI NA OVOM MESTU
i ukoliko neko zeli da cuje moje misljenje o bilo cemu i ako ja budem znao i zeleo da kazem slobodno neka postavi pitanje ali na moj e mail jer ja na ovom mestu vise nemam motiva da se pojavljujem.KRAJ
BUDITE SVI POZDRAVLJENI MILORAD
[ boris Dj.bl @ 12.07.2009. 14:58 ] @
Tema je bas zanimljiva pa da i ja dodam svoje skromno mišljenje...
Kao prvo moram reci da sam ja pobornik teorije determinizma...tj da je sve predodredjeno sadašnjim stanjem...
Sad da malo pojasnim da me ne bi pogrešno razumjeli...naime budućnost i taj protok vremena je najobicnije kretanje...
I kad bismo znali sve najsitnije komponetne i trenutno stanje i brzinu svega u svemiru i kad bi hipoteticki to mogli simulirati u nekom savršenom kompu mogli bi znati i budućnost.
(da ne govorim da ovakav komp realno ne može biti napravljen ni za obradu informacija malog dijela prostora jer ih ima previše podataka)
E sad tu dolazi jedno veliko ALI koje je najbitnije...Iako, barem po meni, sve jeste predodređeno mi niti bilo ko nikad nećemo moći znati tu budućnost zbog Hajzebgerove teorije neodređenosti. Naima ova teorija nije dokazala da je sve neodređeno već je rekla da mi to ne možemo predvidjeti zbog zakona kvantne fizike jer samim skeniranjem stanja recimo fotona mi uticemo na njega i mjenjamo to stanje...
Međutim to što mi nikako ne možemo znati stanje fotona ne znači da ga on nema i to što ne znamo sve zakone kvantne fizike ne znači da ih nema...
Tako da mi ne možemo znati položaj i brzinu fotona ali on ih ipak i po njima se kreće i iako ne znamo zašto neka prođe kroz polupropusnu barijeru a nekad se odbije ipak ima neki razlog.

Znači čovjekovo ponašanje jeste predodređeno ali niko nikad to neće moći predvidjeti...
Sad to ne treba da brine one koji misle da na ovaj nemaju slobodnu volju. Volja je svijest a svijest nije nešto izvan organizma nego upravo posljedica biohemijskih reakcija u mozgu i tijelu.
Tako da neki ubica koji je ubio jeste bio predodređen da ubije kao što smo i mi bili predodređeni da ga zatvorimo ali jednostavno, njegova svijest kao posljedica mozga je odlučila da ubije a naša da ga zatvorimo...čak sasvim je to logično...tako se dalje utiče sutra na svijesti drugih ljudi da to ne rade jer će biti kažnjeni a i on se sprečava da počini novi zločin.

Takođe ja ne sumnjam da će u budućnosti, i to relativno skoro za 30ak do 50ak godina, napraviti robote koji će izgledati kao da imaju inteligenciju, znači vještaču, kao npr u filmu I Robot, gdje će hodati, pričati i raditi kao ljudi i tako im pomagati...
Tad će neki laik moći reći da oni imaju inteligenciju, čak šta više ako uzmemo zvaničnu definiciju inteligenije kao mogućnost učenja i snalaženja onda je opet imaju zbog aloritama obučavanja.
Medjutim ako inteligenciju gledamo narodski rečeno kao svijest onda je neće imati.
Znači oni što po meni nikad neće moći imati jeste svijet, oni uopšte neće biti svjesni da postoje...i dalje će biti samo obične mašine koje za ulaz daju izlaz po nekom algoritmu. Neko će reći ovo su i ljudi, jesu ali ljudi imaju svijet kao posljedicu mozga i svjesni su da postoje, MISLIM DAKLE POSTOJIM !!!
Ovo možda i ne mogu najbolje objasniti ali to je moje mišljenje.
Druga bitna stvar već smo rekli da čovjek nikad neće biti predvidljiv, dok će robot biti...
Npr mi napravimo robota humanoidnog izgleda i nek ima milione i milione IF petlji, moramo mu dati početno stanje...to isto stavimo u neki fiksni komp gdje će biti identičan softver kao u robotu sa istim algoritmima obučavanja...
Zatim uključimo robota i nek se šeta ulicom, a sve njegove ulazne informacije(kamera, mikrofon,senzor pokreta) saljemo bežično u ovaj komp.
Robot će sa svim novim info prolaziti kroz algoritme obučavanja ali isto će i naš komp raditi, i kasnije kad robot dođe na ulicu ovaj komp će nam moći reći da li će robot desno ili lijevo ići...
Čak i kad bi u robotu bio hardverski kvantni generator slučajnih brojeva koji naš komp ne može znati tad nećemo moći dobiti odgovor od kompa gdje će tačno robot skrenuti ali opet bi mogli dobiti informaciju šta bi mogao uraditi...tj spisak svih mogućih akcija robota(konkretna zavisi od onog slučajnog broja) i ovaj spisak će uvijek morati biti konačan jer memorija robota je uvijek konačna pa tako i algoritam u njemu.
Čovjek sa druge strane nije niti će ikad biti predvidiv niti postoji konačni spisak stvari koji bi mogao uraditi...
Zato će onaj naučnik i programer koje je napravio robota na tog 'inteligentnog' robota uvijek gledati kao na običnu mašinu ispod svog nivoa dok će na nekog neobrazovanog seljaka isto možda gledati malo niže ali svakako kao osobu i to mnogo više nego onaj robot...

Eto toliko...nadam se da vam je bar nešto razumljivo...iako sam siguran da će biti dosta neslaganja...ali tome i služi forum...da utvrdimo neslaganja u mišljenjima i il ih zadržimo il ih korigujemo...

[Ovu poruku je menjao boris Dj.bl dana 12.07.2009. u 16:13 GMT+1]
[ galaz @ 12.07.2009. 17:56 ] @
borise, slozio bih se sa tobom kada kazes da je "buduce stanje", apsolutno svega sto postoji, odredjeno nekim "predjasnjim stanjem". znaci, sta god uzeli za primer, to nesto ima svoj tok dogadjaja... spomenuo si elektron, pa hajde da krenemo od njega... zamislimo neki elektron u nekom atomu. ako posmatramo njegovo kretanje, sta utice na njegov polozaj? uticu njegove unutrasnje osobine (njegovo negativno naelektrisanje, na primer) i uticaji sredine, tj. zakoni fizike. i tako za svaki njegov polozaj. zato mozemo da kazemo da je njegov sadasnji polozaj odredjen njegovim prethodnim polozajem... isto tako, njegov buduci polozaj odredjuje sadasnji. ili uzmimo za primer moj monitor. zasto je bas tu gde jeste? zato sto sam ga juce pomerao pa se ne nalazi gde se pre nalazio (spoljasnji uticaj, uticaj sredine) i zato sto jos nije crk'o pa ga jos uvek nisam zamenio (ovo je njegovo unutrasnje stanje). znaci, sve ima svoj tok dogadjaja, i ako taj tok predstavimo pravom (u stvari to ce biti duz, a ne prava) i ako uocimo neku tacku na njoj, recimo "trenutno stanje", to "trenutno stanje" je odredjeno tackom koja se nalazi beskonacno blizu nje i koja predstavlja "predjasnje stanje". tako sva ta "trenutna stanja", kada se sagledaju u celini, cine taj tok dogadjaja. ja sam se u primerima uhvatio za kretanje, tj. polozaj u prostoru jer je to lako da se zamisli, ali mogao sam da se uhvatim za bilo sta. ako sam te dobro razumeo, do ovde se slazemo.

e sad, pre nego sto nastavim, imam jedno pitanje. zamisli da mozemo da "stopiramo" ceo univerzum, pocev od svake elementarne cestice, nasih misli i tako dalje do kretanja zvezda i celih galaksija, znaci apsolutno SVE sto postoji. i sad uradimo copy/paste CELOG univerzuma. pretpostavimo jos da na nas univerzum ne deluju nikakvi spoljasnji uticaji, ako uopste i deluju... pritisnimo sada play u oba univerzuma. :) reci mi, da li bi se ta dva univerzuma identicno "izvrsavala"? ako si vec pobornik teorije o determinizmu, onda bi odgovor trebao da bude "da". to znaci da bi i ti, ja i bilo sta drugo, bilo identicno u oba univerzuma. takodje, svaki nas polozaj, pokret i svaka nasa misao bi bila identicna u oba univerzuma. e, ti tu pravis razliku i kazes da ne bi. ja mislim da bi. dalje, iz ovog mog stava proizilazi da slobodna volja ne postoji. :) svaku nasu misao odredjuje nas prethodni tok misli, kao i sredina, tj. kontekst u kome se nalazimo. ni jedan izbor koji napravimo nije slucajan, ma koliko slucajno izgledao i koliko glup bio. naravno, to ne znaci da je nas zivot manje vredan ili sta vec. ako mene pitate, mi smo deterministicka bica, kao sto je i kompjuter, na kraju krajeva, samo sto mi evoluiramo milionima godina, a zivotinje iz kojih smo nastali su evoluirale jos stotine miliona godina pre nas... razvili smo se toliko da smo u stanju da menjamo svet... naravno, to cine i zivotinje, pa i biljke, ali ni priblizno na nacin kao mi. sve vise spoznajemo svet oko nas, a kad nesto spoznamo, onda smo u stanju to i da menjamo. tako, samo je pitanje vremena kad cemo dovoljno spoznati sebe i to kako razmisljamo, a kad se to desi, bicemo u stanju da napravimo VI.

i jedna mala ispravka, foton se krece brzinom svetlosti. :)
[ Shadowed @ 12.07.2009. 18:05 ] @
Krece se, ali brzina ima jos pravac i smer, pored intenziteta. Jeste poznat intenzitet (brzina svetlosti), ali ne i pravac i smer.
[ boris Dj.bl @ 12.07.2009. 18:39 ] @
Citat:
Shadowed: Krece se, ali brzina ima jos pravac i smer, pored intenziteta. Jeste poznat intenzitet (brzina svetlosti), ali ne i pravac i smer.

Pod brzinom mislim na vektor brzine, znaci intezitet, pravac i smjer.
[ boris Dj.bl @ 12.07.2009. 18:49 ] @
Citat:
galaz:
borise, slozio bih se sa tobom kada kazes da je "buduce stanje", apsolutno svega sto postoji, odredjeno nekim "predjasnjim stanjem". znaci, sta god uzeli za primer, to nesto ima svoj tok dogadjaja... spomenuo si elektron, pa hajde da krenemo od njega... zamislimo neki elektron u nekom atomu. ako posmatramo njegovo kretanje, sta utice na njegov polozaj? uticu njegove unutrasnje osobine (njegovo negativno naelektrisanje, na primer) i uticaji sredine, tj. zakoni fizike. i tako za svaki njegov polozaj. zato mozemo da kazemo da je njegov sadasnji polozaj odredjen njegovim prethodnim polozajem... isto tako, njegov buduci polozaj odredjuje sadasnji. ili uzmimo za primer moj monitor. zasto je bas tu gde jeste? zato sto sam ga juce pomerao pa se ne nalazi gde se pre nalazio (spoljasnji uticaj, uticaj sredine) i zato sto jos nije crk'o pa ga jos uvek nisam zamenio (ovo je njegovo unutrasnje stanje). znaci, sve ima svoj tok dogadjaja, i ako taj tok predstavimo pravom (u stvari to ce biti duz, a ne prava) i ako uocimo neku tacku na njoj, recimo "trenutno stanje", to "trenutno stanje" je odredjeno tackom koja se nalazi beskonacno blizu nje i koja predstavlja "predjasnje stanje". tako sva ta "trenutna stanja", kada se sagledaju u celini, cine taj tok dogadjaja. ja sam se u primerima uhvatio za kretanje, tj. polozaj u prostoru jer je to lako da se zamisli, ali mogao sam da se uhvatim za bilo sta. ako sam te dobro razumeo, do ovde se slazemo.

e sad, pre nego sto nastavim, imam jedno pitanje. zamisli da mozemo da "stopiramo" ceo univerzum, pocev od svake elementarne cestice, nasih misli i tako dalje do kretanja zvezda i celih galaksija, znaci apsolutno SVE sto postoji. i sad uradimo copy/paste CELOG univerzuma. pretpostavimo jos da na nas univerzum ne deluju nikakvi spoljasnji uticaji, ako uopste i deluju... pritisnimo sada play u oba univerzuma. :) reci mi, da li bi se ta dva univerzuma identicno "izvrsavala"? ako si vec pobornik teorije o determinizmu, onda bi odgovor trebao da bude "da". to znaci da bi i ti, ja i bilo sta drugo, bilo identicno u oba univerzuma. takodje, svaki nas polozaj, pokret i svaka nasa misao bi bila identicna u oba univerzuma. e, ti tu pravis razliku i kazes da ne bi. ja mislim da bi. dalje, iz ovog mog stava proizilazi da slobodna volja ne postoji. :) svaku nasu misao odredjuje nas prethodni tok misli, kao i sredina, tj. kontekst u kome se nalazimo. ni jedan izbor koji napravimo nije slucajan, ma koliko slucajno izgledao i koliko glup bio. naravno, to ne znaci da je nas zivot manje vredan ili sta vec. ako mene pitate, mi smo deterministicka bica, kao sto je i kompjuter, na kraju krajeva, samo sto mi evoluiramo milionima godina, a zivotinje iz kojih smo nastali su evoluirale jos stotine miliona godina pre nas... razvili smo se toliko da smo u stanju da menjamo svet... naravno, to cine i zivotinje, pa i biljke, ali ni priblizno na nacin kao mi. sve vise spoznajemo svet oko nas, a kad nesto spoznamo, onda smo u stanju to i da menjamo. tako, samo je pitanje vremena kad cemo dovoljno spoznati sebe i to kako razmisljamo, a kad se to desi, bicemo u stanju da napravimo VI.

i jedna mala ispravka, foton se krece brzinom svetlosti. :)


Bi se identicno izvršavala. Znači DA! Gdje sam ja rekao da ne bi?
Naravno da naš život nije ništa manje vrijedan...to što ja smatram da je sve zbog ovog određeno nema i ne treba imati poseban uticaj na naš život jer niko nikad neće to moći odrediti tako da to nema neki praktičan značaj. Samo možemo konstatovati da je tako, ako se slažemo, i idemo dalje...
A što se tiče VIa već sam rekao šta ćemo moći napraviti a šta ne i zašto, barem ja tako mislim.

I znam da se foton kreće brzinom svjetlosti.

Citat:
galaz:
Krece se, ali brzina ima jos pravac i smer, pored intenziteta. Jeste poznat intenzitet (brzina svetlosti), ali ne i pravac i smer.


Pod brzina sam mislio na vektor brzine, znači intezitet, pravac i smjer.
[ Nedeljko @ 12.07.2009. 19:43 ] @
Citat:
Shadowed: Nedeljko, tacno, ali da li je bitno da li je simulirano na sistemu baziranom na bulovoj algebri? Ako nesto radi neki posao, ono ga radi, bez obzira na cemu se vrti. Zapravo, cinjenica da je simulirano na klasicnim sistemima, pokuzuje da ti klasicni sistemi ipak mogu da postignu isto sto i ono sto simuliraju.

Problem definicije svakako postoji, tj. sta je potrebno da neki sistem bude sposoban da uradi da bismo ga nazvali vestackom inteligencijom.


Znači, teorema je da je sve što je ostvarivo neklasičnim logikama, ostvarivo je i klasičnom, ili ekvivalentno, ako je nešto neostvarivo klasičnom logikom, ni neklasične neće pomoći. Ja iz tvog posta mogu da izvučem zaključak da ti prihvataš mogućnost realizacije VI. Ja smatram da i mogućnost realizacije VI i postojanje PI (prirodne inteligencije) zavise od definicije inteligencije. Samo zaoštrite definiciju inteligencije i ostadosmo bez ljudske inteligencije.

Citat:
karharodon: i bre pa nikada nije bio nikakav problem da se nesto proglasi. samo jedan primer iz oblasti nauke koja nije vezana za ovu temu. dali je u javnosti doprla pre izvesnog vremena informacija da suncev sistem vise nema 9 nego 8 planeta.


Da, nikakav problem proglasiti nešto. Štaviše, po toj definici planete se majčica Zemlja jedva provukla da ostane planeta (jer je težište sistema Zemlja-Mesec tek nešto ispod površine Zemlje).

Citat:
boris Dj.bl: Kao prvo moram reci da sam ja pobornik teorije determinizma...tj da je sve predodredjeno sadašnjim stanjem...


Determinističko shvatanje nikako nije u skladu sa savremenom naukom (u tom smislu se može čak reći da je prevaziđeno), a ni sa mojom intuicijom da smo ipak slobodna bića od kojih ponešto zavisi.
[ galaz @ 12.07.2009. 20:00 ] @
e bas ti se ne da, karharodone... :)

da, borise, ponovo sam procitao tvoj post i vidim da se vise slazemo nego sto sam mislio. :) ali opet donekle. zasto mislis da je svest svojstvena iskljucivo coveku? ili, sta mislis da predstavlja svest? ako je kantovo "mislim, dakle postojim" proizvod svesti (ja takodje mislim da jeste), zar ne mislis da bi do istog zakljucka dosla i neka buduca masina, obradjujuci informacije (da ne kazem misleci) o samoj sebi? biti neceg svestan, pa i samog sebe, znaci biti u mogucnosti da to nesto opises... da mu das odredjeno znacenje... ne mogu da budem svestan neke reci ako za nju nikad nisam cuo, ili ne mogu da budem svestan njenog znacenja ako i ne znam sta znaci. biti neceg svestan == znati nesto o tom necem. emocije, takodje. zasto VI ne bi mogla da ima i emocije? i one se na kraju svode na elektricne impulse u mozgu, bas kao i nase misli. cak sta vise (u jbt, zvucim kao tadic :D), danasnji VI istrazivaci smatraju da ce VI imati i emocije. po cemu ce se onda razlikovati od nas?

Citat:
Shadowed: Krece se, ali brzina ima jos pravac i smer, pored intenziteta. Jeste poznat intenzitet (brzina svetlosti), ali ne i pravac i smer.
koliko si siguran u ovo? koliko se secam fizike iz srednje, ne verujem da je ovo nepoznato. elem, proverio sam na wikipediji i iskreno, mrzelo me je da citam ceo clanak, ali na osnovu onog sto sam procitao izgleda mi da nisi/niste u pravu. foton je cestica EM sile, a to znaci i svetlosti... banalan primer bi bila baterijska lampa, koju kad upalis, svetli u odredjenom pravcu i smeru, a ne "svuda" okolo. elem, ostavljam prostor da nisam u pravu pa bih te zamolio da mi detaljnije objasnis ili da ostavis neki link.

pozz,
vladimir
[ Cola @ 12.07.2009. 20:16 ] @
Ne znam da zašto je bitno da li je ponašanje VI unapred određeno???
Pretpostavimo da jeste, to znači da bi se u istim okolnostima ponašao identično, ali ako se npr. robot u koga je ugrađena ta VI kreće vani na njegove senzore će uticati mnoge stvari (objekti, informacija i sl.) tako da je teško uvjek postići identičnu situaciju pa će se on ponašati uvjek malo drugačije (iako bi se to moglo izračunati ako bi se znali svi parametri ali je praktički nemoguće jer da li je auto naišao kraj robota sada ili za 1 sekundu će malo mijenjati stvari na senzorima).

Evo npr. za funkciaju za slučajni broj takođe može se reći da se može odrediti koji je sledeći ali nama koji se ne zamaramo time on stvarno izgleda kao da je slučajan.

Da li će VI biti bolja od ljudske i da li će se postići??? Moj odgovor je definitivno da i mislim da se na to neće čekati još dugo!!!

Velike prednosti VI nad našom su što VI može da korisrti funkcije u računaru npr. računske operacije sa brojevima može da radi samo tako dok mi peške dok izračunamo koliko je 2321232/327 treba nam vremena, a VI to za tren oka može (znam da deljenje brojeva nije u domenu VI ali ona to može da iskoristi). Takođe VI kako program koji bi se vrtio na nekom procesoru može da sebi menja module (preuzima bolje kao čto mi uzimamo nove verzije programa) dok mi dio svog mozga ne možemo unaprediti ni u najboljim hiruškim salama, i td...

To da li će se napraviti VI da je svjesna sama sebe, to je već pitanje vještačkog života, a mislim da inteligentno ponašanje nije uslovljeno samosvješću!


[ boris Dj.bl @ 12.07.2009. 20:31 ] @
Citat:
Citat:boris Dj.bl:
Kao prvo moram reci da sam ja pobornik teorije determinizma...tj da je sve predodredjeno sadašnjim stanjem...


Citat:
Citat:Nedeljko:
Determinističko shvatanje nikako nije u skladu sa savremenom naukom (u tom smislu se može čak reći da je prevaziđeno), a ni sa mojom intuicijom da smo ipak slobodna bića od kojih ponešto zavisi.


Moja intuicija tvrdi da jeste Determinističko i koliko znam nauka nije dokazala da svemir nije deterministički na način kako sam ja objasnio.
A što se tiče tvoje intuicije i slobodnih bića, sloboda postoji u okviru tvoje svjesti.
Znači imaš svjest koja misli da ona(ti) odlučuje i ona zaista odlučuje ali i ta svijest je posljedica biohemije u mozgu i tijelu što je posljedica atoma, kravkova i bozona i svi čestica koji zavise od početnog položaja i vektora brzine.
Ti se možda ne slažeš sa mojim stavom ali mene još niko nije ubjedio u suprotno.


Citat:
Citat:alaz:
da, borise, ponovo sam procitao tvoj post i vidim da se vise slazemo nego sto sam mislio. :) ali opet donekle. zasto mislis da je svest svojstvena iskljucivo coveku? ili, sta mislis da predstavlja svest? ako je kantovo "mislim, dakle postojim" proizvod svesti (ja takodje mislim da jeste), zar ne mislis da bi do istog zakljucka dosla i neka buduca masina, obradjujuci informacije (da ne kazem misleci) o samoj sebi? biti neceg svestan, pa i samog sebe, znaci biti u mogucnosti da to nesto opises... da mu das odredjeno znacenje... ne mogu da budem svestan neke reci ako za nju nikad nisam cuo, ili ne mogu da budem svestan njenog znacenja ako i ne znam sta znaci. biti neceg svestan == znati nesto o tom necem. emocije, takodje. zasto VI ne bi mogla da ima i emocije? i one se na kraju svode na elektricne impulse u mozgu, bas kao i nase misli. cak sta vise (u jbt, zvucim kao tadic :D), danasnji VI istrazivaci smatraju da ce VI imati i emocije. po cemu ce se onda razlikovati od nas?

Citat:
Shadowed: Krece se, ali brzina ima jos pravac i smer, pored intenziteta. Jeste poznat intenzitet (brzina svetlosti), ali ne i pravac i smer.
koliko si siguran u ovo? koliko se secam fizike iz srednje, ne verujem da je ovo nepoznato. elem, proverio sam na wikipediji i iskreno, mrzelo me je da citam ceo clanak, ali na osnovu onog sto sam procitao izgleda mi da nisi/niste u pravu. foton je cestica EM sile, a to znaci i svetlosti... banalan primer bi bila baterijska lampa, koju kad upalis, svetli u odredjenom pravcu i smeru, a ne "svuda" okolo. elem, ostavljam prostor da nisam u pravu pa bih te zamolio da mi detaljnije objasnis ili da ostavis neki link.


Znači uglavnom se slažemo...eto drago mi je da ima još ljudi koji dijele moje mišljenje makar i donekle...
Svakako mislim da je svijet posljedica mozga i može se pojasniti sa tim Kantovim "mislim, dakle postojim" i po meni za sad je samo ljudi imaju, što naravno ne znači da već nema nekih vanzemaljaca koji su je takođe stekli ili da neće neke životinje evoluirati i steći je.
Takodje teoretski bi bilo moguće i da i taj robot na ovaj način stekne svijest.
Ali ipak i dalje mislim je robot neće steći barem ne ako ostane mehanički kao što su danas računari jer jednostavno robot kakav ja zamišljam u budućnosti je samo jako složen računar koji ni ne može imati svijest nego jako dobro simulira ljudsko ponašanje ali to je ipak u krajnjoj liniji obični algoritam a ne neka svijest.
Druga stvar kao što sam rekao ne možemo niti ćemo moći sve elemente materije skenirati pa sam zato mišljenja da nikad nećemo u potpunosti razumjeti kako to naš mozak stvara samu svijest zbog čega je i nećemo moći kopirati u robota.
Jedino ako uspijemo napraviti biorobota koji neće biti od silicijuma već od živih ćelija pa njemu se učenjem sama stvori svijest kao evolucijom ali to onda i nije 'robot' u klasičnom smislu te riječi već kao neki kiborg...za šta opet danas nema ni pravih teorija kako bi se moglo uradilo...tako da možda nikad ni ne napravimo tog biorobota.

I da foton npr je istovremeno i čestica i talas, to je ono o dualnoj prirodi materije.

Citat:
Citat:Cola:
Ne znam da zašto je bitno da li je ponašanje VI unapred određeno???
Pretpostavimo da jeste, to znači da bi se u istim okolnostima ponašao identično, ali ako se npr. robot u koga je ugrađena ta VI kreće vani na njegove senzore će uticati mnoge stvari (objekti, informacija i sl.) tako da je teško uvjek postići identičnu situaciju pa će se on ponašati uvjek malo drugačije (iako bi se to moglo izračunati ako bi se znali svi parametri ali je praktički nemoguće jer da li je auto naišao kraj robota sada ili za 1 sekundu će malo mijenjati stvari na senzorima).

Evo npr. za funkciaju za slučajni broj takođe može se reći da se može odrediti koji je sledeći ali nama koji se ne zamaramo time on stvarno izgleda kao da je slučajan.

Da li će VI biti bolja od ljudske i da li će se postići??? Moj odgovor je definitivno da i mislim da se na to neće čekati još dugo!!!

Velike prednosti VI nad našom su što VI može da korisrti funkcije u računaru npr. računske operacije sa brojevima može da radi samo tako dok mi peške dok izračunamo koliko je 2321232/327 treba nam vremena, a VI to za tren oka može (znam da deljenje brojeva nije u domenu VI ali ona to može da iskoristi). Takođe VI kako program koji bi se vrtio na nekom procesoru može da sebi menja module (preuzima bolje kao čto mi uzimamo nove verzije programa) dok mi dio svog mozga ne možemo unaprediti ni u najboljim hiruškim salama, i td...

To da li će se napraviti VI da je svjesna sama sebe, to je već pitanje vještačkog života, a mislim da inteligentno ponašanje nije uslovljeno samosvješću!


Ako bolje pročitaš moj prvi post vidjećeš da sam i ja mišeljanja da će VI po klasičnoj definiciji, da se snalazi u novim situacijama i da ima mogućnost da uči(algoritam obučavanja) i tako npr da se robot ponaša kao čovjek na prvi pogled biti napravljena, za 30 do 50 godina.
Biće nešto kao u 'I robot'.
Ali ovdje se često pod inteligencija uzimala i narodska definicija svijest, e tu sam već mišljenja ovo neće imati, eventualno u veoma dalekoj budućnosti ali i to je upitno...

Dakle hoće li postojati VI da se ponaša inteligentno ? Da. (i neke stvari će raditi mnogo bolje od ljudi)
Hoće li imati svjest ? Ne. (i zato neće moći da se eventualno pobuni protiv ljudi)

[Ovu poruku je menjao boris Dj.bl dana 12.07.2009. u 21:45 GMT+1]
[ galaz @ 12.07.2009. 20:55 ] @
karharodone, javi se!! :)))
[ Shadowed @ 12.07.2009. 23:21 ] @
Citat:
Nedeljko: Znači, teorema je da je sve što je ostvarivo neklasičnim logikama, ostvarivo je i klasičnom, ili ekvivalentno, ako je nešto neostvarivo klasičnom logikom, ni neklasične neće pomoći. Ja iz tvog posta mogu da izvučem zaključak da ti prihvataš mogućnost realizacije VI. Ja smatram da i mogućnost realizacije VI i postojanje PI (prirodne inteligencije) zavise od definicije inteligencije. Samo zaoštrite definiciju inteligencije i ostadosmo bez ljudske inteligencije.


Jeste ukoliko se ta neklasicna logika moze simulirati klasicnom (i obratno). Mozda se nisam precizno izrazio, ali iz primera sa kojim smo poceli je jasno na sta mislim.
Yep, prihvatam mogucnost postojanja vestacke inteligencije. Postoji problem sa definicijom, ali mislim da vestacki sistem moze postici sve sto i covek.


Citat:
galaz: koliko si siguran u ovo? koliko se secam fizike iz srednje, ne verujem da je ovo nepoznato. elem, proverio sam na wikipediji i iskreno, mrzelo me je da citam ceo clanak, ali na osnovu onog sto sam procitao izgleda mi da nisi/niste u pravu. foton je cestica EM sile, a to znaci i svetlosti... banalan primer bi bila baterijska lampa, koju kad upalis, svetli u odredjenom pravcu i smeru, a ne "svuda" okolo. elem, ostavljam prostor da nisam u pravu pa bih te zamolio da mi detaljnije objasnis ili da ostavis neki link.

pozz,
vladimir


To je kada gledas svetlosni snop, medjutim, kada posmatras jedan foton, to nije bas tako, ne mozes tacno znati u kojem se smeru krece. Jer, kada mu odredis polozaj, ti si mu promenio pravac kretanja.

Citat:
galaz: karharodone, javi se!! :)))

Ne vredi, obrisah mu vec 10ak praznih poruka i usput mu skrenuo paznju da obrati paznju na uputstvo u mail-u (posto odgovara preko mail-a), al' uporno salje prazne poruke.
Nadam se da cemo videti odgovor uskoro :)
[ karharodon @ 13.07.2009. 00:25 ] @
evo da pokusam ovako da se javim evo jedne od poruka koje sam poslao ali izgleda da frajeri brisu a i to me zabole nisu oni jedini koji posmatraju
AKO TAKO MI I TREBA.LJUDI MANITE SE CORAVA POSLA I BAVITE SE NECIM STO CE KORISTITI I VAMA I DRUGIMA.ovo vazi za mladje a matori mogu da se zezaju sa VI koliko hoce.i jos nesto vezano za ime ovog sajta[jel se tako kaze za elitesekjuriti] i za glavnog.dali ovo sluzi za mi6 da nesto prikupi i eventualno nekog angazuje i da mu za to daje mrvice sa njihove bogate trpezarije
evo ovako da pokusam da se javim pa kazi ili pitaj
[ne brisu frajeri nego ja ne znam da radim na komp a i prvi mi je put da sam aktivan na jednom ovakvom sajtu]
ove moje greske u vezi pisanja poruka su posledica neznanja i dugog boravka u sredini koja je daleko ispod nivoa mozgova koji pisu ovde i meni nije nikakav problem danas da sa mozgovima razgovaram uzivo a vec danas mi nije problem i da pisem na ovom sajtu
kad se odspava bolje se misli he he

[Ovu poruku je menjao karharodon dana 13.07.2009. u 07:44 GMT+1]

[Ovu poruku je menjao karharodon dana 13.07.2009. u 08:16 GMT+1]

[Ovu poruku je menjao karharodon dana 13.07.2009. u 08:17 GMT+1]

[Ovu poruku je menjao karharodon dana 13.07.2009. u 08:19 GMT+1]
[ karharodon @ 13.07.2009. 00:56 ] @
ad sam shvatio da sistem automatski brise poruke koje sam poslao kao odgovore na poruke koje su dosle na moj e mail.pa cinimise da sam rekao da malo znam da radim na racunaru a i ne zanima me mnogo sada cu da posaljem sve sto sam poslao ukljucujuci i onu predhodnu pa moderatoru brisi ako ti se ne svidja ovo sto ja pisem

gospodine ajde da okoncamo ovaj intelektualni duel na temu VI KOJA SE PROSIRILA
samo da vam odgovorim na ovo pismo i verujte mi iako mi je bilo naporno jer nisam naucio da vodim polemiku sa intelektualcima[da ne kazem sa mozgovima],uzivao sam u dijalogu.mislim da sam ja o VI rekao sve sto sam hteo da kazem ali sa vama mogu i zelim uvek da razmenim misljenje o bilo cemu ako znam ,ukoliko mislite da bi vam to bilo zanimljivo.za mene ne postoje tabu teme ,znam da postoje grupe ljudi koji su pod zavetom cutanja ali ja sam solo igrac ali nisam ni informativni biro i uvek pricam istinu vodeci pri tom racuna kome pricam, kako pricam,kada pricam ,sta pricam i zasto pricam[e za ovo zasto nisam uvek siguran]
ja logiku poznajem samo onu koja se mislim zove bulova algebra i na kojoj se zasniva digitalna elektronika.postoji kineski simbol bozanstva koji se sastoji od crnog belog ,u belom malo crno i u crnom malo belo.
to sto nismo putovali 2001 na jupiter pa nisu ni amerikanci stigli na mesec ali pricaju o tome.tu ideju je prvi opisao zil vern u svojoj knjizi put na mesec ali u toj knjizi su glavni likovi promasili mesec i vratili se na zemlju
sto se tice mog profesora branislava kuzmanovica koji je predavao osnovi elektrotehnike na elitnom vojno tehnickom fakultetu pri vojno tehnickoj akademiji u zagrebu[studirao sam od 1983 do 1988 10 semestara]njegovu relevantnost potvrdjuje samo njegovo prisustvo na akademiji.na toj akademiji je 1987 stigao PC ali sam ja radio diplomski na epll u jer je bio mnogo mocniji a u to vreme je vecina ljudi mislila da je racunar nesto sto se maze na leba
u vezi logike nesto sam nekad znao ali posto nisam imao prilike da primenjujem zaboravio sam.da postoje vise vrsta logike to meni nije poznati
moram na ovom mestu da potkrepim misao o logici jednim vicem
cita haso knjigu u parku prilazi mu mujo i pita
sta to citas haso
logiku
a sta ti je to
sad cu da ti objasnim,jel imas kuci akvarijum
imam
ako imas akvarijum onda volis zivotinje jel tako
tako je
ako volis zivotinje onda volis ljude jel tako
tako je
ako volis ljude volis zene jel tako
tako je
ako volis zene nisi peder
aaa ... sad mi je jasno
nego odo ja pa cu se vratiti a ti za to vreme malo citaj
mujo kao cita i nailazi suljo
sta to radis mujo
citam logiku
a sta ti je to
sad cu da ti objasnim jel imas kuci akvarijum
nemam
nemas...
nemam
...mars pederu
verovatnocu veoma malo ili uopste ne uzimam u obzir kada je u pitanju pragmatika a ja volim da zivim i da se radujem zivotu
za mene VI ne pretstavlja nikakav problem jer znam da to nece moci da se postigne,he pa ja iako mislim da puno znam i mislim da sam nesto prosao u zivotu opet ne znam sta ce mi zivot doneti ali zivim iz sve snage u uslovima u kojima sam i radim na tome da mi bude bolje pa dokle stignem.eh mozda je inteligencija i znanje stetno za kvalitet zivota.lepo kaze stari zavet da je adam isteran iz raja kada je jeo plodove znanja dobra i zla.lepo je govorio moj prijatelj sto manje znas manje patis a i svestenici savetuju da treba biti ovca u stadu.dali su oni u pravu

postovanje gospodine i pozdrav milorad
[ karharodon @ 13.07.2009. 00:59 ] @
zdravo boris.samnom je studirao stanivukovic ranko iz bl koji je sada u ceskoj.on je sampiuon za racunare.pisem ti samo zato sto vidim da si mozak ,sto si iz bl i sto si pobornik determinizma.ja ne znam sta je to i posteno nezanima me ali mi je privuklo paznju tvoje obrazlozenje tog pojma.prema indijskim spisima postoji zakon karme[uzrocno posledicne veze] koji otprilike kaze da svaki potez u zadasnjosti ima uticaja na buducnost i svaki potez u proslosti utice na sadasnjost.ali juce i sutra postoji samo u nasem mozgu a zivi danas punim zivotom i pokusaj da ga ispunis onim sto hoces bez obzira sta je to .MLAD SI JEBES TEORIJU ZIVI ZIVOT
pozdrav milorad
[ karharodon @ 13.07.2009. 01:03 ] @
ovo bas nerazumem.jeste li vi elitna bezbednost ili niste ajde da igramo otvorenih karata da se gledamo oco u oci ja sam pa svi vi pa kom opanci kom obojci
[prva recenica se odnosi na prazne poruke ali sada znam nisam ja komp ja ucim]

[Ovu poruku je menjao karharodon dana 13.07.2009. u 07:39 GMT+1]
[ karharodon @ 13.07.2009. 01:09 ] @
samo cu da pitam u vezi elektrona.dali je nauka uspela da odredi polozaj elektrona u atomu.mozda ja nisam obavesten.nije nikakav problem nesto srusiti ajde da se nesto izgradi.zasto niko nije iskoristio bezzicni prenos energije koji je patentirao tesla pa da i sirotinja ima struju
[ karharodon @ 13.07.2009. 01:14 ] @
mozda ja nisam obavesten ali koliko sam ja znao fizicari nisu uspeli da se dogovore dali je svetlost materijalne ili talasne prirode nego su to definisali kada im odgovara nekad talas nekad cestice uostalom mnoge stvari u zapadnoj[hriscanskoj] nauci su stvar dogovora
[ karharodon @ 13.07.2009. 01:19 ] @
samo jedna misao.nekako mi se urezalo u secanje da je inteligencija reagovanje na dogadjaje[potsticaje]bez predhodnog iskustva.dali sam u pravu ili nisam posteno bas me vise briga
[ Shadowed @ 13.07.2009. 07:48 ] @
Odgovoricu ti ukratko, ali bih te zamolio da ne skreces toliko sa teme.

Citat:
ad sam shvatio da sistem automatski brise poruke koje sam poslao kao odgovore na poruke koje su dosle na moj e mail.pa cinimise da sam rekao da malo znam da radim na racunaru a i ne zanima me mnogo sada cu da posaljem sve sto sam poslao ukljucujuci i onu predhodnu pa moderatoru brisi ako ti se ne svidja ovo sto ja pisem


Ne brise sistem automatski, nego si odgovarao preko mail-a a nisi procitao uputstvo pa su stizale prazne poruke i ja sam ih obrisao.

Citat:
karharodon: samo cu da pitam u vezi elektrona.dali je nauka uspela da odredi polozaj elektrona u atomu.mozda ja nisam obavesten.nije nikakav problem nesto srusiti ajde da se nesto izgradi.zasto niko nije iskoristio bezzicni prenos energije koji je patentirao tesla pa da i sirotinja ima struju

Ne postoji tako nesto kao polozaj elektrona u atomu jer se elektron krece. Za sve elementarne cestice vazi princip neodredjenosti a to je da sto tacnije odredjujes njihov polozaj to vise utices na njihovo stanje pa ti je njihova brzina manje poznata.
Tesla nije napravio niti patentirao bezicni prenos el. energije koji se moze koristiti za distribuciju. I to nema veze sa ovom temom.

Citat:
karharodon: mozda ja nisam obavesten ali koliko sam ja znao fizicari nisu uspeli da se dogovore dali je svetlost materijalne ili talasne prirode nego su to definisali kada im odgovara nekad talas nekad cestice uostalom mnoge stvari u zapadnoj[hriscanskoj] nauci su stvar dogovora


Svetlost ima dualnu prirodu. Ima karakteristike i cestice i talasa i mozes je posmatrati bilo kao cesticu, bilo kao talas, ali ne smes zanemariti i ono drugo (zakljucak nastao na osnovu talasne prirode ne sme biti u suprotnosti sa cesticnom prirodom svetlosti i obrnuto).
Ovo poslednje je non-sense kao i sam pojam "hriscanske nauke".
[ Nedeljko @ 13.07.2009. 08:25 ] @
Citat:
Shadowed: ali mislim da vestacki sistem moze postici sve sto i covek.


Ovo je već iskaz kome nisu potrebne dodatne definicije (ako se misli samo na rešavanje raznih problema, a ne i na kategorije kao što je unutrašnja svest o sebi ili nečemu drugom). No, ja nisam baš najsigurniji da je taj iskaz tačan. O tome treba debelo porazmisliti.

Citat:
boris Dj.bl: Moja intuicija tvrdi da jeste Determinističko i koliko znam nauka nije dokazala da svemir nije deterministički na način kako sam ja objasnio.


Ti si dao istu formulaciju determinizma koja se koristi u nauci. Dakle, nije problem u formulaciji, oko nje se slažemo. Sve makroskopske fizičke teorije su determinističke (uključujući klasičnu mehaniku sa gravitacijom, specijalnu relativnost sa elektrodinamikom, opštu relativnost, termodinamiku), ali kvantna mehanika, kvantna elektrodinamika i standardni model su probabilistički, dok se determinizam makroskopskih teorija objašnjava graničnim teoremama teorije verovatnoće. Po navedenim probabilističkim teorijama su sadašnjim stanjem u budućnosti jedino određeni ukupan impuls ukupna masa i ukupna energija u slučaju kvantne mehanike, ili ukupan impuls i ukupna masa+energija u slučaju druge dve. Osim toga, određene su verovatnoće raznih događaja u budućnosti. Takođe postoje i rezultati koji se ne pozivaju na konkretnu teoriju (jer ni ove sadašnje nisu savršene, niti će ikada postojati savršen opsi prirode), već koji se odnose na apstraktnu teoriju. Vidi paradoks Ajnštajna, Rozena i Podolskog i teoremu Bela. Nije baš da se tvrdi da zakoni moraju biti probabilistički, već da je neke kombinacija u kojoj učestvuje determinizam isključene. Opšteprihvaćeno mišljenje savremenih fizičara (znači, preko 99,9% istraživača) je da probabilizam tih teorija nije deo njihovog nesavršenstva, već karakter prirodnih zakona.
[ Nedeljko @ 13.07.2009. 10:36 ] @
Citat:
Shadowed: Ne postoji tako nesto kao polozaj elektrona u atomu jer se elektron krece. Za sve elementarne cestice vazi princip neodredjenosti a to je da sto tacnije odredjujes njihov polozaj to vise utices na njihovo stanje pa ti je njihova brzina manje poznata.
Tesla nije napravio niti patentirao bezicni prenos el. energije koji se moze koristiti za distribuciju. I to nema veze sa ovom temom.


Postoji stanje odredjeno sa 4 kvantna broja.
[ Nedeljko @ 13.07.2009. 13:44 ] @
Kakve veze ima 0-1 logika sa mogucnošću ostvarivanja VI? Na 0-1 logici je izgrađena celokupna matematika. Sve fizičke teorije se mogu ispričati unutar te logike. Zašto je to argument protiv VI? Takođe, podsetiću te da i ljudski mozak ima ograničenu složenost, pa se ljudi ipak smatraju inteligentnim bićima. Dakle, postoje biološka ograničenja onoga što možemo shvatiti.
[ galaz @ 13.07.2009. 16:07 ] @
nedeljko, probacu jos malo da objasnim nas stav (borisov i moj, posto se tu slazemo)... kvantna fizika je NAS pokusaj da opisemo mikrosvet. naglasavam nas, iz naseg ugla, jer mi nismo u mogucnosti (a mozda nikad i necemo biti) da tacno opisemo neke pojave na kvantnom nivou. svaki put kad pokusamo tim nasim pokusajem izmenimo pojavu koju opisujemo. i to svi znamo. upravo su nam zbog toga neophodni svi ti probabilisticki zakoni fizike. ali, to uopste ne znaci da je i sama priroda probabilisticka, neodredjena. zamisli da mozemo da se smanjimo na nivo elektrona i da sa strane posmatramo atom. mislim da ne bismo primetili bas nista neodredjeno. jednostavno, ne mislim da se u prirodi bilo sta desava slucajno vec da samo nama, usled nemogucnosti da neke stvari sagledamo do detalja, one izgledaju slucajno. i naravno, tada se sluzimo probabilistickim zakonima kako bi bar donekle opisali te pojave. mozda ce nam neke prirodne pojave zauvek ostati "crna kutija", ali to takodje ne znaci da se ne odvijaju po tacno odredjenim, deterministickim zakonima. i koliko sam upucen (a trebalo bi da jesam, bar toliko) ni jedan od tih 99,99% naucnika ne negira determinizam... takodje, svi cemo se sloziti da su nam probabilisticke teorije i zakoni neophodni upravo zbog toga sto neke pojave, usled nemogucnosti da ih spoznamo do poslednjeg detalja, mozemo jedino tako da opisemo. btw, ovo se naziva naucni determinizam i tu se boris i ja slazemo, a donekle u vezi bioloskog determinizma.
Citat:
karharodon: a da energija postoji u svakoj materiji to su znali jos stari indijci cija su dela napisana na sanskritu.

jel znas ko je prvi povezao energiju i materiju? albert ajnstajn, 1905., svojom formulom E = mc^2. do tad su ljudi odvojeno posmatrali energiju i materiju. e sad, ti ces reci da je to ustvari uradila mileva a da je ajnstajn samo prepisivao od nje... salim se malo, nemoj da mi zameris. :)
Citat:
Nedeljko: Takođe, podsetiću te da i ljudski mozak ima ograničenu složenost, pa se ljudi ipak smatraju inteligentnim bićima.

zar upravo to sto si rekao da mozak ima ogranicenu slozenost ne ide vise u prilog tezi da je VI moguca nego da nije, jer ako je nesto ogranicene slozenosti, onda su mnogo vece sanse da cemo nekad biti u mogucnosti da spoznamo tu slozenost, pa stoga i da napravimo VI, nego da necemo?
[ karharodon @ 13.07.2009. 17:35 ] @
galaz ko bre kaze da je ljudski mozak ogranicen.ogranicena je njegova upotreba kod pojedinca vise ili manje a samim tim bi i eventualna VI koju napravi covek ili objavi da ju je napravio bila ogranicena.meni je problem kako da ovu moju prirodnu inteligenciju upotrebim za zivot koji bi bio ispunjen ljubavlju i lepotom koju cu mozda nekada i da dostignem ali VI nikada nebi mogla da bude samostalna a pogotovu ne da oseca i cemu bi sluzila takva VI
[ karharodon @ 13.07.2009. 18:41 ] @
goranu miailovicu se ne svidja jedna moja poruka na temu VI PA JU JE OBRISAO verovatno on zna zasto ali iskreno to me je obradovalo
[ galaz @ 13.07.2009. 19:42 ] @
karharodone, naravno da je ogranicen. prvo, nije beskonacno tezak nego oko 1,5 kg. nema ni beskonacno mnogo celija, vec oko 100 milijardi... kao i konacan broj sinapsi izmedju tih neurona. ni ti neuroni nisu svemoguci, cak su relativno prosti: imaju ulaze, nesto rade i to nesto prosledjuju na svoje izlaze. i nista vise od toga. na kraju, ogranicene su i njegove mogucnosti.

evo ti jedan primer: pusti masti na volju i probaj da zamislis nesto, bilo sta, sto ne bi mogao da svedes na pojmove koje vec znas... mozda si zamislio neku rec, recimo "shfsdovnsoidfvdf". sta mozes da mi kazes o njoj? to da je rec, da se sastoji od nekih slova (koja su nam opet poznata) i tako dalje... ali ne, hteo sam da zamislis nesto sto ne bi mogao da opises sa pojmovima kao sto su "rec", "slova" i tako dalje, sa pojmovima koje vec znas... mozda si zamislio neku figuru. ok, ali ponovo, tu predstavu u glavi opet mozes da opises sa pojmovima kao sto su "oblik", "boja", "prostor" itd. ustvari, mozes da se trudis koliko hoces i opet neces uspeti. sta hocu da kazem? ne mozemo da izadjemo van granica svog znanja, sta god probali da uradimo. svaka nasa misao (bila ona razumna ili puko mastanje) je ogranicena znanjem koje imamo. ne mozemo da zamislimo pojam a da ne mozemo da ga opisemo nekim drugim pojmom. to je kao da zamisljamo nezamislivo. opet, ne mozemo da izadjemo van granica svog znanja. ok, ali mi svakog dana prosirujemo svoje znanje?! upravo to, prosirujemo, nadogradjujemo, ali ne mozemo van njegovih granica. da je mozak neogranicen u svojim mogucnostima, i mi bismo bili u svojim razmisljanjima, pa bi nam svakakve stvari padale na pamet, stvari koje ne bi mogli da svedemo na pojmove koje vec imamo.

odatle i proizilazi moj stav o VI. ako nismo neograniceni u svojim razmisljanjima, onda cemo jednog dana spoznati nas mozak do detalja i tada cemo napraviti VI. naravno, i VI ce biti ogranicena u svojim mogucnostima.

a ti, karharodone, ako ti je problem da pronadjes ljubav i lepotu u zivotu, mozda bi trebao svu svoju inteligenciju da usmeris na to, a ne da je trosis ovde na forumu... jbg, nisam mogao da odolim. :))
[ Shadowed @ 13.07.2009. 20:29 ] @
Ili jednostavnije - probaj da zamislis novu boju :)
[ karharodon @ 13.07.2009. 22:57 ] @
prema kantu postoje 4 kategorije na osnovu kojih se formira misljenje o svim pojmovima to so kvantitet,kvalitet,kauzalnost, e jbg zaboravio sam koja je cetvrta kategorija ali nije bitno.sopenhauer je u jednoj svojoj knjizi[zbog koje sam jedva sacuvao razum],koja u predgovoru kaze da to nije knjiga za svakog ,nije knjiga za mali broj odabranih ,vec samo za jednog i gde izmedju ostalog kaze da svaki pojam ima u sebi deo nekog drugog pojma a ovaj sledeceg swve do jedne ili druge krajnjosti koje su DOBRO a druga krajnjost ZLO.STO SE TICE LJUDSKOG MOZGA NAUCNICI SU INSTRUMENTIMA IZMERILI I JA MISLIM I SLIKALI NESTO OKO LJUDSKOG TELA STO SU CINIMI SE NAZVALI AURA
i na kraju prihvaticu tvoj savet da se usredsredim na prakticne stvari a o VI neka raspravlja neko drugi ja vise necu
budite pozdravljeni od karharodona [ipak mi se vise svidja orka] t.j. milorada
[ boris Dj.bl @ 14.07.2009. 00:17 ] @
Citat:

Citat:karharodon
zdravo boris.samnom je studirao stanivukovic ranko iz bl koji je sada u ceskoj.on je sampiuon za racunare.pisem ti samo zato sto vidim da si mozak ,sto si iz bl i sto si pobornik determinizma.ja ne znam sta je to i posteno nezanima me ali mi je privuklo paznju tvoje obrazlozenje tog pojma.prema indijskim spisima postoji zakon karme[uzrocno posledicne veze] koji otprilike kaze da svaki potez u zadasnjosti ima uticaja na buducnost i svaki potez u proslosti utice na sadasnjost.ali juce i sutra postoji samo u nasem mozgu a zivi danas punim zivotom i pokusaj da ga ispunis onim sto hoces bez obzira sta je to .MLAD SI JEBES TEORIJU ZIVI ZIVOT
pozdrav milorad


Pozdravi i tebi Milorade...ti si bas neki zanimljiv lik ovdje...
Ne znam ti doticnog prijatelja al ako je iz BL vjerujem da je pametan...da malo hvalim svoje lijepo mjesto...
Uglavnom determinizam ti znaci odredjenost...nema tu neke neshvatljive nauke...ako si detaljno procitao moj post tamo ti je sve objasnjeno...barem iz moje prespektive...i sto se toga tice ja tu ne gledam nikakvu karmu niti sudbini nego iskljucivo sa aspekta nauce strane da svi elementi su svemiru se krecu uzrocno posljedicno...
Tako da je ZIVIM ZIVOT sasvim dovoljno...izlasci, druzenje, more, skijanje, rafting (nije da se hvalim nego da ne mislis da sam neki frik cim mi govoris ZIVI ZIVOT)...itd uz to i faks a malo i navratim ovdje, obicno za neke konkretne stvari a ponekad vidim o cemu se filozofira i na ovakvim temama pa usput dam svoje skromno misljenje...

Citat:

Citat:galaz
nedeljko, probacu jos malo da objasnim nas stav (borisov i moj, posto se tu slazemo)... kvantna fizika je NAS pokusaj da opisemo mikrosvet. naglasavam nas, iz naseg ugla, jer mi nismo u mogucnosti (a mozda nikad i necemo biti) da tacno opisemo neke pojave na kvantnom nivou. svaki put kad pokusamo tim nasim pokusajem izmenimo pojavu koju opisujemo. i to svi znamo. upravo su nam zbog toga neophodni svi ti probabilisticki zakoni fizike. ali, to uopste ne znaci da je i sama priroda probabilisticka, neodredjena. zamisli da mozemo da se smanjimo na nivo elektrona i da sa strane posmatramo atom. mislim da ne bismo primetili bas nista neodredjeno. jednostavno, ne mislim da se u prirodi bilo sta desava slucajno vec da samo nama, usled nemogucnosti da neke stvari sagledamo do detalja, one izgledaju slucajno. i naravno, tada se sluzimo probabilistickim zakonima kako bi bar donekle opisali te pojave. mozda ce nam neke prirodne pojave zauvek ostati "crna kutija", ali to takodje ne znaci da se ne odvijaju po tacno odredjenim, deterministickim zakonima. i koliko sam upucen (a trebalo bi da jesam, bar toliko) ni jedan od tih 99,99% naucnika ne negira determinizam... takodje, svi cemo se sloziti da su nam probabilisticke teorije i zakoni neophodni upravo zbog toga sto neke pojave, usled nemogucnosti da ih spoznamo do poslednjeg detalja, mozemo jedino tako da opisemo. btw, ovo se naziva naucni determinizam i tu se boris i ja slazemo, a donekle u vezi bioloskog determinizma.
Citat:
karharodon: a da energija postoji u svakoj materiji to su znali jos stari indijci cija su dela napisana na sanskritu.

jel znas ko je prvi povezao energiju i materiju? albert ajnstajn, 1905., svojom formulom E = mc^2. do tad su ljudi odvojeno posmatrali energiju i materiju. e sad, ti ces reci da je to ustvari uradila mileva a da je ajnstajn samo prepisivao od nje... salim se malo, nemoj da mi zameris. :)
Citat:
Nedeljko: Takođe, podsetiću te da i ljudski mozak ima ograničenu složenost, pa se ljudi ipak smatraju inteligentnim bićima.

zar upravo to sto si rekao da mozak ima ogranicenu slozenost ne ide vise u prilog tezi da je VI moguca nego da nije, jer ako je nesto ogranicene slozenosti, onda su mnogo vece sanse da cemo nekad biti u mogucnosti da spoznamo tu slozenost, pa stoga i da napravimo VI, nego da necemo?


Ne bih ni sam mogao bolje reci(ovaj prvi post) tako da je Nedeljko vec dobio odgovor.
A sto se tice same vjestacke inteligencije da ponovim svoj stav:
"Ako bolje pročitaš moj prvi post vidjećeš da sam i ja mišeljanja da će VI po klasičnoj definiciji, da se snalazi u novim situacijama i da ima mogućnost da uči(algoritam obučavanja) i tako npr da se robot ponaša kao čovjek na prvi pogled biti napravljena, za 30 do 50 godina.
Biće nešto kao u 'I robot'.
Ali ovdje se često pod inteligencija uzimala i narodska definicija svijest, e tu sam već mišljenja ovo neće imati, eventualno u veoma dalekoj budućnosti ali i to je upitno...

Dakle hoće li postojati VI da se ponaša inteligentno ? Da. (i neke stvari će raditi mnogo bolje od ljudi)
Hoće li imati svjest ? Ne. (i zato neće moći da se eventualno pobuni protiv ljudi)".

Tako da svijest jeste posljedica mozga ali ja ne vjerujem da cemo ikad moci toliko spoznati mozak da otkrijemo samu svijest u potpunosti pa da je onda kreiramo i na robotu, jer takva analiza bi zahtjevala skeniranje na kvantnom nivou(cak pretpostavimo da cemo imati neke kvantne skenere) a to nit mozemo raditi na zivom mozgu, a svijest samo tad i postoji, em bi tako uticali na mozak i promijenili ga...
Sad nisam siguran da li i po ovom pitanju se slazemo il ne bas u potpunosti...
[ Nedeljko @ 14.07.2009. 07:59 ] @
Citat:
galaz: nedeljko, probacu jos malo da objasnim nas stav (borisov i moj, posto se tu slazemo)... kvantna fizika je NAS pokusaj da opisemo mikrosvet. naglasavam nas, iz naseg ugla, jer mi nismo u mogucnosti (a mozda nikad i necemo biti) da tacno opisemo neke pojave na kvantnom nivou. svaki put kad pokusamo tim nasim pokusajem izmenimo pojavu koju opisujemo. i to svi znamo. upravo su nam zbog toga neophodni svi ti probabilisticki zakoni fizike. ali, to uopste ne znaci da je i sama priroda probabilisticka, neodredjena. zamisli da mozemo da se smanjimo na nivo elektrona i da sa strane posmatramo atom. mislim da ne bismo primetili bas nista neodredjeno. jednostavno, ne mislim da se u prirodi bilo sta desava slucajno vec da samo nama, usled nemogucnosti da neke stvari sagledamo do detalja, one izgledaju slucajno. i naravno, tada se sluzimo probabilistickim zakonima kako bi bar donekle opisali te pojave. mozda ce nam neke prirodne pojave zauvek ostati "crna kutija", ali to takodje ne znaci da se ne odvijaju po tacno odredjenim, deterministickim zakonima. i koliko sam upucen (a trebalo bi da jesam, bar toliko) ni jedan od tih 99,99% naucnika ne negira determinizam... takodje, svi cemo se sloziti da su nam probabilisticke teorije i zakoni neophodni upravo zbog toga sto neke pojave, usled nemogucnosti da ih spoznamo do poslednjeg detalja, mozemo jedino tako da opisemo. btw, ovo se naziva naucni determinizam i tu se boris i ja slazemo, a donekle u vezi bioloskog determinizma.


U pravu si da to što je par teorija probabilističko ne znači da je i priroda takva. Međutim, iz malo jačih razloga se veruje da priroda jeste takva, to jest da probabilizam nije posledica nesavršenstva tih teorija, već da je sam karakter prirodnih zakona takav, koliko god mi imali nepotpuno i nesavršeno znanje o njima. Da, relevantni naučnici negiraju determinizam. Jasno je meni o čemu vi pričate, ali to nije u skladu sa današnjom naukom.

Citat:
galaz: zar upravo to sto si rekao da mozak ima ogranicenu slozenost ne ide vise u prilog tezi da je VI moguca nego da nije, jer ako je nesto ogranicene slozenosti, onda su mnogo vece sanse da cemo nekad biti u mogucnosti da spoznamo tu slozenost, pa stoga i da napravimo VI, nego da necemo?


Naravno.
[ Shadowed @ 14.07.2009. 08:46 ] @
Citat:
Nedeljko: Međutim, iz malo jačih razloga se veruje da priroda jeste takva, to jest da probabilizam nije posledica nesavršenstva tih teorija, već da je sam karakter prirodnih zakona takav, koliko god mi imali nepotpuno i nesavršeno znanje o njima.

Mozes li reci koji su to razlozi, posto smo jednom prilikom pricali ovde na jedno 10 strana u nekoj temi (mozda i 20) ali nisu dati konkretni razlozi vec se svelo upravo na to da mi nalazimo zakonitosti u onome sto vidimo i da ako ne mozemo detektovati nesto onda to i ne postoji, tj. nije relevantno. Dimkovic bese najveci zagovornik tog stava.
[ boris Dj.bl @ 14.07.2009. 10:14 ] @
Citat:

Citat:Nedeljko:
Međutim, iz malo jačih razloga se veruje da priroda jeste takva, to jest da probabilizam nije posledica nesavršenstva tih teorija, već da je sam karakter prirodnih zakona takav, koliko god mi imali nepotpuno i nesavršeno znanje o njima.

Citat:

Citat:Shadowed:
Mozes li reci koji su to razlozi, posto smo jednom prilikom pricali ovde na jedno 10 strana u nekoj temi (mozda i 20) ali nisu dati konkretni razlozi vec se svelo upravo na to da mi nalazimo zakonitosti u onome sto vidimo i da ako ne mozemo detektovati nesto onda to i ne postoji, tj. nije relevantno. Dimkovic bese najveci zagovornik tog stava.



I sam je rekao da se vjeruje, znaci cak i da ima nekih razloga oni nisu dovoljno jaki da stvore argument a kamoli dokaz vec iskljucivo vjerovanje...
Eto i ja vjerujem da priroda jeste deterministicka u naucnom smislu da svo krenjenja ima svoj uzrok makar ga mi i ne znali...a neki ocigledno ne vjeruju...
Naravno niko od nas nema dokaz ni za sta samo misljenja i pretpostavke pa koje misljenje nam blize dodje...meni licno ovo jer mi nerealno da tamo neka cestica koju jos recimo nismo ni otkrili se krece bez iakvog zakona i moze da radi bilo sta kad sve dosad sto smo otkrili je imalo uzroke i zakone...
I ja mislim da sve sto ne znamo donekle zanemarujemo...recimo jos mi ne znamo zasto foton nekad prodje kroz polupropustivlju barijeru a zasto se nekad odbije ali to sto mi ne znamo razlog u kojem se jedan slucaj razlikuje od drugog za znaci da ga nema...i dok eventualno i tu ne bude pronadjena neka zakonitost mnogi ce smatrati da je eto slucajno...jer mnogi je lakse reci slucajno je nego ne znamo !!!
[ Nedeljko @ 14.07.2009. 11:01 ] @
Vec sam pomenuo paradoks Ajnstajna, Rozena i Podolskog i nejednacinu Bela. Odatle sledi da priroda ne moze istovremeno zadovoljavati princip lokalnosti i determinizam. Nikakva lokalna deterministicka teorija ne moze proci izvrsene eksperimente. Cvrstog dokaza za nedeterminizam nema. No, ako cemo tako, voleo bih da vidim svrste dokaze za determinizam. Primenite iste kriterijume na svoje stavove.

Citat:
Wikipedia / Indeterminism /Science: At one time, it was assumed in the physical sciences that if the behavior observed in a system cannot be predicted, the problem is due to lack of fine-grained information, so that a sufficiently detailed investigation would eventually result in a deterministic theory ("If you knew exactly all the forces acting on the dice, you would be able to predict which number comes up"). However, the advent of quantum mechanics removed the underpinning from that approach, with the claim that (at least according to the Copenhagen interpretation) the most basic constituents of matter behave indeterministically, in accordance with such properties as the uncertainty principle. Quantum indeterminism was controversial on its introduction, with Einstein among the opposition, but gradually gained ground. Experiments confirmed the correctness of quantum mechanics, with a test of the Bell's theorem by Alain Aspect being particularly important because it showed that determinism and locality cannot both be true. Bohmian quantum mechanics remains the main attempt to preserve determinism (albeit at the expense of locality).


Dakle, postoje alternativne teorije koje pokusavaju da zadrze determinizam, ali one nisu opsteprihvacene, vec alternativne. Medju relevantnim naucnicima je preovladjujuce shvatanje nedeterministicko, ali eto, ima i izuzetaka medju njima. Prema sadasnjem stanju u fizici, savremene deterministicke teorije su samo granicni slucajevi osnovnih nedeterministickih teorija - njihove aproksimacije za sisteme sa velikim brojem cestica i njihov determinizam se objasnjava granicnim teoremama teorije verovatnoce. Nedeterministicke teorije objasnjavaju sve sto i deterministicke i jos ponesto sto deterministicke nisu uspele.

Koliko vidim, vama je jedini argument za determinizam prosta cinjenica da, eto, vi verujete u to.
[ galaz @ 14.07.2009. 14:22 ] @
ok, da sumiram, ti mislis/tvrdis da u prirodi postoje posledice koje nemaju svoj uzrok?
[ Nedeljko @ 14.07.2009. 15:32 ] @
Ne, nego da se pod istim okolnostima mogu desiti razlicite stvari (eventualno sa razlicitim verovatnocama).
[ boris Dj.bl @ 14.07.2009. 17:19 ] @
Citat:
Citat:Nedeljko:
Ne, nego da se pod istim okolnostima mogu desiti razlicite stvari (eventualno sa razlicitim verovatnocama).


Sad sam sebi kontriras...
Prvo ne kazes da stvari nemaju uzrok a onda kazes kako se pod apsolutno istim okolnostima mogu desiti razlicite stvari.
Odluci se za jedno jer po meni oboje ne moze.
Ako se u nekoj situaciji nesto desi uzrokovano necim i ako smo prije toga uzeli 'snapshot' svemira i poslije ga opet od tad pustili onda ce onaj isti uzrok postojati i desice se ono isto...
Vjerovatnoca postoji kao nas odnos prema necemu sto ne znamo dovoljno dobro da kazemo desice se to sigurno...pa zato samo nagadjamo i kazemo to se moze desiti a i ne mora...ali ono sto se desi je imalo svoj uzrok i pod apsolutno svim istim okolnostima bi se moralo isto desiti.
Ako bi se desilo drugacije onda to i nema uzrok nego se onako slucajno samo od sebe desilo...
[ Cola @ 14.07.2009. 17:49 ] @
Super tema za forum, samo ne vidim kave veze ima sa ovom temeom?
[ galaz @ 14.07.2009. 18:43 ] @
to je da bi malo osvezili temu... :) sto se mene tice, neka nedeljko odgovori na poslednji borisov post i mozemo da se vratimo na temu.
[ Nedeljko @ 14.07.2009. 19:38 ] @
Citat:
boris Dj.bl: Sad sam sebi kontriras...
Prvo ne kazes da stvari nemaju uzrok a onda kazes kako se pod apsolutno istim okolnostima mogu desiti razlicite stvari.
Odluci se za jedno jer po meni oboje ne moze.
Ako se u nekoj situaciji nesto desi uzrokovano necim i ako smo prije toga uzeli 'snapshot' svemira i poslije ga opet od tad pustili onda ce onaj isti uzrok postojati i desice se ono isto...


Ne kontriram. Isti taj snapshot svemira će drugi put imati drugačije posledice. Uostalom, slobodno tumačite pojmove uzroka i posledice kako hoćete. Suština je da snapshot svemra određuje verovatnoće događaja u budućnosti, a ne same događaje. Naravno, te verovatnoće bitno zavise od snapshota (trenutnog stanja svemira), odnosno, stanje učestvuje u računu verovatnoća.

Citat:
boris Dj.bl: Vjerovatnoca postoji kao nas odnos prema necemu sto ne znamo dovoljno dobro da kazemo desice se to sigurno...pa zato samo nagadjamo i kazemo to se moze desiti a i ne mora...ali ono sto se desi je imalo svoj uzrok i pod apsolutno svim istim okolnostima bi se moralo isto desiti.
Ako bi se desilo drugacije onda to i nema uzrok nego se onako slucajno samo od sebe desilo...


A zašto verovatnoću vezuješ samo za neznanje? Zato što a priori isključuješ mogućnost da je verovatnoća sastavni deo prirodnih zakona. No, takav se iskaz svodi na puko ponavljanje ličnog stava da je priroda deterministička. Još uvek nema nijednog argumenta u pravcu determinizma. Konačnih dokaza o probabilizmu za sada nema, ali je argumentacija u korist probabilizma trenutno u svakom pogledu jača od argumentacije u korist determinizma. Determinizam nema trenutno nijedan argument na koji probabilizam nema prihvatljiv odgovor i ne postoji nijedan argument u korist determinizma koji se ne može dati i u korist probabilizma. Sa druge strane, postoje argumenti u korist probabilizma koje determinizam nema:

1. Dokazano je da prirodni zakoni ne mogu biti istovremeno i lokalni i deterministički.
2. Trenutno stanje u nauci je takvo da se svi fenomeni koji su ikako objašnjivi fizikom, objašnjivi probabilističkim teorijama.
3. Probabilizam ima potpuno prihvatljiv odgovor na pitanje zašto se prihvaćene determinističke teorije dobro slažu sa eksperimentima.
4. Determinističke teorije su istorijski starije i jednostavnije.
5. Determinističke teorije su samo aproksimacija probabilističkih, pri čemu su probabilističke opstije i tačnije.
[ boris Dj.bl @ 14.07.2009. 20:29 ] @
Priznajem otisli smo od teme...ali usmejerno tj samo diskusija od VI je dosla na pitanje determinizma i mogucnosti potpunog shvatanja mozga u buducnosti da bi cak napravili i svijest u robotu za sta sam tvrdio da nece biti moguce...
Samo jos da odgovorim Nedeljku i necu vise...hehe

Citat:
Citat:boris Dj.bl:
Sad sam sebi kontriras...
Prvo ne kazes da stvari nemaju uzrok a onda kazes kako se pod apsolutno istim okolnostima mogu desiti razlicite stvari.
Odluci se za jedno jer po meni oboje ne moze.
Ako se u nekoj situaciji nesto desi uzrokovano necim i ako smo prije toga uzeli 'snapshot' svemira i poslije ga opet od tad pustili onda ce onaj isti uzrok postojati i desice se ono isto...


Citat:
Citat:Nedeljko:
Ne kontriram. Isti taj snapshot svemira će drugi put imati drugačije posledice. Uostalom, slobodno tumačite pojmove uzroka i posledice kako hoćete. Suština je da snapshot svemra određuje verovatnoće događaja u budućnosti, a ne same događaje. Naravno, te verovatnoće bitno zavise od snapshota (trenutnog stanja svemira), odnosno, stanje učestvuje u računu verovatnoća.


Ok, sad shvatam tvoje misljenje iako se i dalje s tim ne slazem...
Po tebi znaci trenutno stanje svemira ne odredjuje jednoznacno neko buduce stanje vec ostavlja mogucnosti za vise razlicitih stanja odredjenih vjerovatnoca...
Tako da to sta ce se od tih stanja zaista desiti ne odredjuju nikakva pravila ni zakoni vec se slucajno neko stanje od tih mogucih desi...
Po meni takva slucajnost uopste ne postoji...

Citat:
Citat:boris Dj.bl:
Vjerovatnoca postoji kao nas odnos prema necemu sto ne znamo dovoljno dobro da kazemo desice se to sigurno...pa zato samo nagadjamo i kazemo to se moze desiti a i ne mora...ali ono sto se desi je imalo svoj uzrok i pod apsolutno svim istim okolnostima bi se moralo isto desiti.
Ako bi se desilo drugacije onda to i nema uzrok nego se onako slucajno samo od sebe desilo...


Citat:
Citat:Nedeljko:
A zašto verovatnoću vezuješ samo za neznanje? Zato što a priori isključuješ mogućnost da je verovatnoća sastavni deo prirodnih zakona. No, takav se iskaz svodi na puko ponavljanje ličnog stava da je priroda deterministička. Još uvek nema nijednog argumenta u pravcu determinizma. Konačnih dokaza o probabilizmu za sada nema, ali je argumentacija u korist probabilizma trenutno u svakom pogledu jača od argumentacije u korist determinizma. Determinizam nema trenutno nijedan argument na koji probabilizam nema prihvatljiv odgovor i ne postoji nijedan argument u korist determinizma koji se ne može dati i u korist probabilizma. Sa druge strane, postoje argumenti u korist probabilizma koje determinizam nema:

1. Dokazano je da prirodni zakoni ne mogu biti istovremeno i lokalni i deterministički.
2. Trenutno stanje u nauci je takvo da se svi fenomeni koji su ikako objašnjivi fizikom, objašnjivi probabilističkim teorijama.
3. Probabilizam ima potpuno prihvatljiv odgovor na pitanje zašto se prihvaćene determinističke teorije dobro slažu sa eksperimentima.
4. Determinističke teorije su istorijski starije i jednostavnije.
5. Determinističke teorije su samo aproksimacija probabilističkih, pri čemu su probabilističke opstije i tačnije.


Pazi ja sam odmah rekao da dokazi ne postoje vec samo nasa misljenja...
Zasto ti a priori ukljucujes...i to je tvoj licni stav da je priroda nije deterministicka u naucnom smislu...
A ovo nisu bas validni argumetni...mogu i ja napisati isto samo kontra...evo npr:
1. Ovo ti bas ne kontam...prvo sta ti znaci 'lokalni' i drugo gdje je to i kako dokazano...
2. Prvo neki fenomeni nisu jos uopste objasnjeni...a to sto smo mi negdje uveli vjerovatnocu jer ne znamo tacno ne znaci da ta vjerovatnoca zaista postoji i da to nije odredjeno nekim zakonom koji jos uopte ne znamo ni da postoji ( mislim na kvanti nivo ).
3. Kazes "Probabilizam ima potpuno prihvatljiv odgovor na pitanje zašto se prihvaćene determinističke teorije dobro slažu sa eksperimentima", determinizam ni nema potrebu da daje odgovor kad vec ima teorije provjerene u praksi za ono sto nam je poznato...mnoge stvari jos ne znamo...nesto cemo tek otkriti a nesto mozda necemo nikada...
4. pa ?
5. Probabilističkih pokusavaju opisati i ono sto ne znamo...a Determinističke ne ali ponavljam to sto mi ne znamo sve kvantne zakone ne znaci da oni ne postoje

Uglavnom da zavrsimo sa ovim...
Jasni su nam medjusobni stavovi...slazemo se da se ne slazemo
Dokaza nema ni za jednu teoriju vec su ovo prvenstveno nasa misljenja za koja mi imamo svoje razloge i to je to...
[ vlaiv @ 15.07.2009. 07:51 ] @
Nisam pomno pratio sve postove, ali vidim oko cega se vodi diskusija.

Voleo bi da dam par smernica prilikom diskutovanja o inteligenciji (posebno vestackoj), cisto
da bi ljudima bilo lakse da ucestvuju u kvalitetnoj diskusiji vezanoj za ovu temu.

Sve sto mi znamo o univerzumu, determinizmu, verovatnoci i tome slicno je model.
Model koji se sa manjim ili vecim odstupanjima ponasa u skladu sa ocekivanjima
bazirano na nasoj percepciji.

Percepcija je kljucna rec. Inteligencija nije apsolutna velicina, nego relativna.
Takodje zavisi i od percepcije.

Vestacka inteligencija je takodje model. I u zavisnosti od percepcije onog
ko ocenjuje moze da ispuni ili ne ispuni uslov "inteligentnosti".

Da li roboti sanjaju elektronske ovce? Budimo realni, ako cemo u filozofiju
ja ne mogu da tvrdim da bilo ko osim mene sanja. Kazu ljudi da sanjaju i
sve sto ja mogu jeste da verujem u to (ili pak ne).

Sustina vestacke inteligencije nije masina koja jeste covek. Nego koja
se u vecoj ili manjoj meri ponasa tako. I sustina tog ponasanja jeste da
se omoguci bolja interakcija takve masine sa covekom, jer covek je navikao
da komunicira sa drugim ljudima i takva komunikacija mu je najjednostavnija
i najprirodnija.

Sto se tice same simulacije odnosno modela, matematika kaze da je moguce
simulirati bilo kakvo ponasanje, cak i ono "ne isprogramirano". Odnosno
moguce je napraviti model koji po kompleksnosti prevazilazi ocenjivaca i
samim tim dovesti ocenjivaca u poziciju da zakljuci da se radi o "inteligenciji".

Ono sto mi ocenjujemo kao emocija jeste nasa percepcija reakcije na odredjene
stimulanse i uslove i bazirano je na nasem iskustvu.

Ukoliko dobijemo odgovarajucu reakciju na odgovarajuce stimulanse, mozemo
zakljuciti da to nesto sto je reagovalo oseca. Isto tako ako se bavimo filozofijom
ne mozemo znati da li neko ko ima reakciju a ljudsko bice je u pitanju (ili pak zivo bice)
zapravo ima datu emociju (mozda glumi, mozda se ponasa shodno ocekivanjima, a mozda
samo ja osecam, otkud znam da li to i drugi cine, tako se ponasaju, ali sta mi garantuje? :D )

Po mom misljenju, uvek ce se moci filozofirati i zauzimati odredjen stav da li ovako ili onako.
Ali to nije diskusija koja je konstruktivna (sem eventualno za mentalnu gimnastiku i ucenje
sposobnosti da se stvar sagleda iz razlicitih uglova).

Sustina diskusije o Vestackoj Inteligenciji bi trebalo da bude u tome kako je napraviti
(simulitati) i za cega iskoristiti a ne da li ce dovoljno dobar model "imati dushu" :D
[ Nedeljko @ 15.07.2009. 11:01 ] @
Citat:
boris Dj.bl: Tako da to sta ce se od tih stanja zaista desiti ne odredjuju nikakva pravila ni zakoni vec se slucajno neko stanje od tih mogucih desi...


Zakoni određuju verovatnoće događaja u budućnosti, što nama ljudima ostavlja prostora za slobodno odlučivanje šta ćemo da radimo.

Citat:
boris Dj.bl: Pazi ja sam odmah rekao da dokazi ne postoje vec samo nasa misljenja...


Dokazi ne postoje, već argumenti u pravcu jednog ili drugog stanovišta. Neka od tih mišljenja imaju jaču argumentaciju.

Citat:
boris Dj.bl: Zasto ti a priori ukljucujes...i to je tvoj licni stav da je priroda nije deterministicka u naucnom smislu...
A ovo nisu bas validni argumetni...mogu i ja napisati isto samo kontra...evo npr:
1. Ovo ti bas ne kontam...prvo sta ti znaci 'lokalni' i drugo gdje je to i kako dokazano...
2. Prvo neki fenomeni nisu jos uopste objasnjeni...a to sto smo mi negdje uveli vjerovatnocu jer ne znamo tacno ne znaci da ta vjerovatnoca zaista postoji i da to nije odredjeno nekim zakonom koji jos uopte ne znamo ni da postoji ( mislim na kvanti nivo ).
3. Kazes "Probabilizam ima potpuno prihvatljiv odgovor na pitanje zašto se prihvaćene determinističke teorije dobro slažu sa eksperimentima", determinizam ni nema potrebu da daje odgovor kad vec ima teorije provjerene u praksi za ono sto nam je poznato...mnoge stvari jos ne znamo...nesto cemo tek otkriti a nesto mozda necemo nikada...
4. pa ?
5. Probabilističkih pokusavaju opisati i ono sto ne znamo...a Determinističke ne ali ponavljam to sto mi ne znamo sve kvantne zakone ne znaci da oni ne postoje

Uglavnom da zavrsimo sa ovim...
Jasni su nam medjusobni stavovi...slazemo se da se ne slazemo
Dokaza nema ni za jednu teoriju vec su ovo prvenstveno nasa misljenja za koja mi imamo svoje razloge i to je to...


1. Lokalnost znači da dešavanja ovde ne mogu uticati trenutno ne dešavanja na nekom udaljenom mestu, već da je za to neophodno da prođe neko vreme. Sve postojeće prihvaćene determinističke teorije su lokalne, a upravo je to isključeno - determinizam + lokalnost istovremeno. Bar jedno od to dvoje ne važi za prirodu, pa samim tim nijedna postojeća prihvaćena deterministička teorija nije prihvatljiva, osim u smislu koji probabilizam uspešno objašnjava (slaganje tih determinističkih teorija sa eksperimentim je posledica graničnih teorema teorije verovatnoće, to jest, one su približno tačne u sistemima sa velikim brojem čestica, ali eto, postoje i ovakvi eksperimenti koje takve teorije ne mogu nikako da objasne, a probabilističko objašnjenje postoji). Dakle, ovde simetrije između determinizma nema.

2. Neke stvari nisu objašnjene uopšte, neke su objašnjene samo probabilistički, a neke i probabilistički i deterministički. Nema nijednog fenomena koji ima determinističko objašnjenje, a da nema probabilističko. Dakle, ni ovde nema simetrije, jer je probabilizam uspešniji.

3. Determinizam ima potrebu da objasni neke stvari koje probabilizam uspešno objašnjava. Taj problem je rešen samo u suprotnom smeru. Dobro, priznajem da se determinizam može pozivati na trenutno neznanje. Međutim, ni to ne može večito. Deterministi bi morali da nađu nelokalne determinističke zamene za probabilističke teorije. Sa druge strane, probabilističke su trenutno opštije i tačnije - determinističke su samo njihovi granični slučajevi, tj. aproksimacije. Gde god razlika postaje uočljiva, probabilizam pobeđuje.

4. Pa, ništa, novije teorije su savršenije od starijih. Ranije nije bilo mogućnosti da se uoči probabilističnost prirode, a onda se razvojem nauke stiglo do tog stupnja.

5. Probabilističke teorije zasad ne samo da pokušavaju da objasne ono što determinističke ne uspevaju, nego pritom i uspevaju u tome. Obrnuto ne. Samo priča o neznanju, a nigde praktične vajde od toga.



No, ja ne smatram da to ima previše veze sa VI.
[ Nedeljko @ 15.07.2009. 11:12 ] @
vlaiv je napisao odličan post, pa bih da odgovorim na njega.

Citat:
vlaiv: Da li roboti sanjaju elektronske ovce? Budimo realni, ako cemo u filozofiju
ja ne mogu da tvrdim da bilo ko osim mene sanja. Kazu ljudi da sanjaju i
sve sto ja mogu jeste da verujem u to (ili pak ne).


Ako idemo tako daleko, ja ne mogu da dokažem da postoji iko osim mene, ali ond anema ni nauke. Jednostavno se ne može ići toliko daleko. Ljudi imaju snove i to je činjenica. Roboti ih nemaju, jer znamo šta se dešava u njima i nigde nema ničega približnog sanjanju.

Citat:
vlaiv: Sustina vestacke inteligencije nije masina koja jeste covek. Nego koja
se u vecoj ili manjoj meri ponasa tako. I sustina tog ponasanja jeste da
se omoguci bolja interakcija takve masine sa covekom, jer covek je navikao
da komunicira sa drugim ljudima i takva komunikacija mu je najjednostavnija
i najprirodnija.


Ovo je najpribližnije praktičnoj definiciji VI - da je to objast koja se bavi rešavanjem onih problema na računaru, koje čovek trenutno rešava bolje. No, ima i drugih definicij i odgovor zavisi od formulacije onoga što se traži.

Citat:
vlaiv: Ono sto mi ocenjujemo kao emocija jeste nasa percepcija reakcije na odredjene
stimulanse i uslove i bazirano je na nasem iskustvu.


Moje iskustvo o mojim emocijama je jedno, a moje iskustvo o tuđim emocijama nešto sasvim drugo.
[ Shadowed @ 15.07.2009. 14:30 ] @
Citat:
Nedeljko: Zakoni određuju verovatnoće događaja u budućnosti, što nama ljudima ostavlja prostora za slobodno odlučivanje šta ćemo da radimo.


To pod uslovom da kvantni efekti imaju bitnog uticaja na makroskopskom nivou na kojem se odlucivanje odvija.
[ Nedeljko @ 16.07.2009. 08:02 ] @
Odlučivanje se odvija na mikroskopskom nivou. Naš mozak je električna mašina sa ogromnim brojem signala od kojih preusmeravanje jedne slabašne strujice može bitno uticati na ceo sistem. To je kao kada malom snagom pritisneš dugme, a taj pritisak utiče da se oslobodi ogromna energija koja pomera kran. Da, neodređenosti na nivou na kome se vrši odlučivanje su značajne, pa samim tim i naše makroskopsko ponašanje koje bitno od toga zavisi.
[ Nebojsa Marinkov @ 20.12.2009. 19:38 ] @
Baš mi je čudno da se na ovakvom forumu ovoliko dugo priča o V.I. a da neuronske mreže nisu ostale centralna tema.

Fazi logika je odavno prevazišla granice nula i jedinica i rešila probleme paradoksa. Jeste da se u računaru sve svodi na 0 i 1 ali fazi logika predstavlja nacin povezivanja tih nula i jedinica sa ljudskim načinom razmišljanja pomoću lingvističkih fazi promenljivih(npr. starost, temperatura...) koje uzimaju vrednosti fazi skupova (npr dete,mladić, starac ili hladno,mlako,vrelo...). Većina vas jesu mladići ali sa odredjenom merom. Recimo neko ko ima 21 god je mladić 100%, a neko ko ima 33 god je mladić 55%. Naravno ove mere su subjektivne i zavise od onoga ko projektuje fazi sistem.

Fazi pravila tipa ako-onda (IF-THEN) koje operišu sa fazi promenljivima se u potpunosti mogu opisati recima ljudskog jezika i preneti na računar. Ako vam onaj ko ima iskustva sa upravljanjem kranom izdeklamije jedno 15-ak fazi pravila, moći ćete da napravite fazi kontroler koji će isto tako uspešno upravljati kranom kao i živ čovek.

E sad, da predjemo na neuronske mreže. To su sistemi izuzetne procesorske snage i velikih memorijskih kapaciteta koji su sposobni da UČE i da se PRILAGODJAVAJU. Učenje se obavlja na osnovu iskustva. Možda se i vama kao i meni na vozačkoj obuci gasio auto, možda ja katkad instruktor morao da legne na kočnicu da se ne biste slupali i sl. Pravili ste greške, a kasnije se broj gresaka smanjivao dok niste naučili da vozite. I vaša vožnja se i posle obuke usavršavala iskustvom. Tako i neuronska mreža uči usavršavanjem i ponavljanjem. Postoje i neuronske mreže za prepoznavanje oblika, prepoznavanje govora, za restauraciju slika... Ljudski mozak je jedna ogromna biološka neuronska mreža sa 1011 neurona, malo drugačije realizovana od veštačkih. Tako kompleksnu veštačku NM je gotovo ne moguće realizovati.

Spregom fazi i neuro sistema dobijamo moćne sisteme upravljanja. Sada vam čak ni ne treba čovek sa iskustvom da bi formirao fazi pravila za upravljanje kranom, već možete obučiti neuronsku mrežu da upravlja kranom pa će ona sama formirati fazi pravila i usavršavati ih tokom rada.

Dakle, možemo odmah u startu da zaobidjemo priču o 0 i 1, kao i priču o tvrdim algoritmima i matematičkim modelima. Neuronske mreže su poprilično ne istražene (kao i sama ljudska inteligencija), i ja verujem da će doći do ogromnih rezultata na polju veštačke inteligencije u narednih, šta znam 50, 100, 200 godina.

Pre samo 20 godina i manje postojali su ne upućeni (političari i sl. intelektualci) koji su tvrdnje da će računari jednoga dana moći da pustaju muziku odbacivala kao čistu glupost, tako da sada ne treba tako olako tvrditi da je nesto ne moguće. Dakle ja verujam da će se kreirati neki inteligentan sistem koji ce moci da prepozna vaše lice i da kaže ' zdravo Stevo, kako si?'. Samo nikad ne može biti toliko savršen kao prirodni inteligentni sistem kao što ni jedan foto aparat nije toliko savršen kao ljudsko ili životinjsko oko.

Izvinjavam se zbog ogromnog posta, nije moglo kraće majke mi. Ovo je samo deo onoga što smo učili na fakultetu, a učili smo veoma kratko i sažeto, tako da ima tu mnogo što šta da se kaže (npr. fazi i genetski algoritmi..itd). Takodje se izvinjavam ako je već bilo priče o ovome, stvarno me je mrzelo da čitam sve postove.
[ Nedeljko @ 10.01.2011. 15:35 ] @
Citat:
Nebojsa Marinkov: Baš mi je čudno da se na ovakvom forumu ovoliko dugo priča o V.I. a da neuronske mreže nisu ostale centralna tema.


A što bi bile? Neuronske mreže su se odlično pokazale u oblasti prepoznavanja oblika, ali oblasti veštačke inteligencije ima daleko više.
[ Nedeljko @ 10.01.2011. 15:38 ] @
Citat:
Nebojsa Marinkov: Sada vam čak ni ne treba čovek sa iskustvom da bi formirao fazi pravila za upravljanje kranom, već možete obučiti neuronsku mrežu da upravlja kranom pa će ona sama formirati fazi pravila i usavršavati ih tokom rada.


A kako misliš da je obučiš za nešto bez eksperta za to? Svašta!

Citat:
Nebojsa Marinkov: Pre samo 20 godina i manje postojali su ne upućeni (političari i sl. intelektualci) koji su tvrdnje da će računari jednoga dana moći da pustaju muziku odbacivala kao čistu glupost, tako da sada ne treba tako olako tvrditi da je nesto ne moguće. Dakle ja verujam da će se kreirati neki inteligentan sistem koji ce moci da prepozna vaše lice i da kaže ' zdravo Stevo, kako si?'. Samo nikad ne može biti toliko savršen kao prirodni inteligentni sistem kao što ni jedan foto aparat nije toliko savršen kao ljudsko ili životinjsko oko.


Jedno je kad nešto tvrde diletanti za tu oblast, a sasvim drugo kada se nemogućnost nečega dokaže kao matematička teorema.
[ galaz @ 19.01.2011. 00:45 ] @
Citat:
Nebojsa Marinkov: Baš mi je čudno da se na ovakvom forumu ovoliko dugo priča o VI a da neuronske mreže nisu ostale centralna tema.

neuronske mreže predstavljaju samo jednu oblast veštačke inteligencije. samostalno, one nikako ne mogu da daju kompletno rešenje za veštačku inteligenciju.
[ v0idmp3 @ 01.12.2011. 13:53 ] @
Pozdrav svima,

Potrudio sam se da procitam celu temu od pocetka do kraja...ima stvarno raznoraznih teorija o nacinu funkcionisanja bioloskog mozga po cijem modelu bi mogla da se napravi AI, odnosno VI. Neke su veoma razumne, druge komplikovane, trece nemaju smisla...itd. Vec duze vreme razmisljam o projektovanju obicnog chat bota (samo malo drugaciji, sa drugacijim pristupom), i naravno on mora da poseduje odredjeni stepen VI. Citao sam dosta clanaka/postova po raznim sajtovima i raznim forumima, i primetio sam da svako ima svoju teoriju o principima rada samog ljudskog mozga. Jednostavno svako ima odgovor kako mozak razmislja, misli, sta je svest itd

Tako da sam posle duzeg mozganja dosao do neke "Svoje" teorije (izvinjavam se ako vec postoji ta teorija, sta zna jedan osamnaestogodisnjak sta sve postoji), pa bi voleo da cujem vase kritike. Sve cu probati da uprostim i da svedem na samu bazu moje "teorije", dok bi u praksi bilo sve to vise (hiljada) puta multiplicirano.

Moja teorija se bazira da mozak je u sustini jedan veoma kompleksan i slozen racunar. Prvo treba napraviti podelu izmedju tzv "hardware" i "software" ljudskog mozga. Misim da se svi slazemo da je hardware bukvalno sve sto mi, ljudi, imamo...ruke, noge, oci, usi, prsti, osecaj dodira(senzor)...cak je i sam mozak hardware. Software je vec malo slozenija i apstraknija stvar jer je nemoguce predstaviti ga opipljivo. Software mozga je, po mom razmisljanju, program koji odlucuje, memorise, izvrsava, i predstavlja (kada zamisljamo slike). Ali vraticu se na to kasnije.

Na nekim stranicama postavljeno je pitane kako covek razmislja. Gledao sam dosta teorija na tu temu, i dosao do neke svoje teorije. Svi mi primamo nadrzaje iz spoljnog sveta. Ukoliko podjemo od toga da u mozgu postoji memorija, ciji jedan deo smo dobili preko DNK koda (osnovne, funkcionalne stvari, npr. Kako sisati majcino mleko, kako plakati...to niko ne uci, sa tim smo se rodili), zatim da postoji ona apstraktna stvar koja se naziva KARAKTER i/ili EMOCIJE (prvo je vecim delom nasledno - podjite od sebe, dok je drugi deo trenutna stvar) i na kraju, ne znam kako bi ga nazvao, ali ajde nekim kompjuterskim zargonom, PROCESOR u mozgu. Naravno postoje i ulazni uredjaji (oci, usi, dodir...)

Ja mislim da mozak prvenstveno radi na principu verovatnoce. U sustini, iz svoje memorije, izvlaci vise podataka koji imaju najvecu verovatnocu slicnosti sa odredjenim nadrazajem iz spoljasnosti. Pretpostavljam da cete me pitati, "A kako onda ja mogu da uradim nesto sto je suprotno svim logikama"...tu na scenu dolazi KARAKTER/EMOCIJE...Zamislite da se izmedju tzv. procesora i memorije nalazi jos jedan "cip" nazvan karakter. Ukoliko osobine tog cipa budu npr. "tvrdoglavost", osoba ce ubedjivati npr. drugu osobu da je sneg crn, iako njegov mozak ima u memoriji pohranjenu informaciju da je sneg beo, i da je verovatnoca, (izmedju milion boja pohranjenih u memoriji) informacije koju je video preko svojih senzora (oci) 100% da je to bela. Tu vec ulazimo u varijabilitet istinosti podataka koje covek kaze, tj. koje iz coveka dobijamo u vidu output-a.
Imam jos jedan primer...npr. otisli ste sa devojkom u zenski butik (situacija koja se meni desila, i koja je za mene bila eureka), i ugledali komad cudne odece. Mozak velikom brzinom obradjuje podatak koji je primio. Taj komad odece je licio i na pantalone i na bluzu (jako cudan komad odece, iskreno)..."procesor" u mojoj glavi je izracunao sta je verovatnije (npr majca 20%, pantalone 40%, dzemper 40%), posto u memoriji nije bilo pohranjeno predhodno iskustvo sa istim/slicnim objektom tako da mozak nije znao tacno sta je to. Tu na scenu nastupa onaj cip zvani "karakter/emocija". Posto sam malo tvrdoglav, poceo sam da ubedjujem svoju devojku da su to pantalone, iako ni sam nisam bio siguran, ali je procenat verovatnoce da su to pantalno rastao srazmerno ubedjivanju nje. Ona je, posto takodje nije znala sta je to, mene ubedjivala da je to bluza. I nikako nismo mogli da slozimo. Na kraju je otisla u garderobu i obukla taj komad odece i dokazala mi da je to u sutini dzemper. U tom trenutku, kada sam ja nju video, posto nisam preterano tvrdoglav, moj mozak je u svoju memoriju pohranio infomaciju da je taj "objekat" 100% dzemper i da sledecu put kada vidi taj isti/slican objekat, bice veca verovatnoca da kao output posalje informaciju "dzemper". Da sam tvrdoglaviji i dalje bi tvrdio da su to pantalone :)

Ovo sto sam sve ispisao, mozda malo deluje konfuzno, ali kada se zapitamo malo bolje, videcete da u sustini mozak tako funkcionise. Uostalom kako ste uopste naucili npr. koja je koja boja i kako je prepoznajete, a opet zasto se ubedjujete sa nekim oko nijanse neke boje...znate ono, on tvrdi da je crvena, a vi da je roze (to je onaj cip zvani karakter/emocija)

Dolazimo do pitanja, kako mozak uci...zamislite da vidite neki objekat koji prvi put u zivotu vidite. Mozak prvo, preko svog procesora, pretrazuje memoriju, tj. trazi vezu sa odredjenim delom memorije u koji je pohranjen oblik i informacija o nazivu tog objekta. I nasao je npr. 100 podataka ali nijedan nema veliku verovatnocu da je to taj objekat koji vidimo. I mozak kaze "Aha, nemam veliku verovatnocu ajde da naucim sta je to". Pokusava prvo da sam, intuicijom, tj. sklapanjem vise razlicitih informacija o slicnim objektima da stvori sliku (npr. automobil...krece se, ima tockove, cuje se kako radi motor, prevozi putnike...to je automobil). Ukoliko ne uspe ili ga mrzi (opet onaj cip zvani karakter), on jednostavno pita "Sta je to?" Informaije koje dobije, on ce da pohrani u svoju memoriju i sledeci put kada vidi isti/slican objekat on ce imati informaciju sa velikom verovatnocom (iako mozda ta informacija nije tacna)


Nadam se da ste razumeli sta sam hteo da kazem. Jako bi voleo da cujem vase komentare

[ Shadowed @ 19.03.2015. 13:59 ] @
Bump :)